ORFeome > MGC115694 ORF1 – XORFeome v1.0

MGC115694 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6255577
Gene Page ID:
ORF Xenbase ID: 17257209

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099057
Original XGC clone length: 1884

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: E06

Sequences - 5ʹ (forward) EST

Accession: JZ838385
dbEST ID: 79656087
Trimmed Sequence: ATGTCTGACGGAAACCCACCACTACTGATGCTTCCCCAACCAAAGCCCCTGAGGTTGCCAGTCCACCGCCACGGCGAAGAGGACGCCCCCGTCTCATTAGGCCAAACGCAGAGAATTCCAGCAAGAGCTT
Full Trace Sequence: GGGTCTTATGGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGACGGAAACCCACCACTACTGATGCTTCCCCAACCAAAGCCCCTGAGGTTGCCAGTCCACCGCCACGGCGAAGAGGACGCCCCCGTCTCATTAGGCCAAACGCAGAGAATTCCAGCAAGAGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCCGTAAAAAAAAAGATACAAAAAAATGCTACGAGCCTATGGGAACACGCCGGGTCAAGAACACCTAAGACTCTACTGCCACAACTGGGCTGCGATTATAAAGTTGCTGGTTGATGAAAGCCGGGGAAACAGATGAGAGAACCCTCCGGCCGGACATAGACTTGTTGGAATCGCACGCTGCGGGCGCAGGATTGTATACACTACACACAACTGGGCGGGAACCTTGGCCCACCGCATCGGTGGAAGGTGAGCACTGGCTTTTTTTATGAAATGGAACTAACGGATGGCTAGGGGAAAAGTCCATAACCCCGGGGATGGGTCCGGGTGGCCGCGACTCCCATGGTGTTGTATGGCGGATGGTAGCCCTTACCCCCCCCAAGGATAATTACCAGGTGGGGGGGGGGGGGCCAGTTCGACACCATCTTTAATTTTTTTTGCTAAAAGGCAACGGGGGGGAACGCCCCCCGGCGAGCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGACGGAAACCCACCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838384
dbEST ID: 79656086
Trimmed Sequence: GCTCTTGCTGGAATTCTCTGCGTTTGGCCTAATGAGACGGGGGCGTCCTCTTCGCCGTGGCGGTGGACTGGCAACCTCAGGGGCTTTGGTTGGGGAAGCATCATTACTGGTGGGTTTCCGTCAAACATGGTGGCAACTTTTTTGTAGGAAGTTCGCATTATAANAAAGCATTTCTCCGCAATTTCTTGCGGCGGAGAGGGCGCTATCAGTCAAAGGAAGAAGGGTAGGTTGGGAGGGGAGTTCGGAACTAGANCNGGNCCAGAAAAAAAAAAAAGAAAAGATTAACATCGCGTGCTCTGGAAAGCGGGGGGACAAAAAAATAAAAGGCTCTGCCGACCAAGGGGGGGTGGTGGGTGAGATCGTGGGGATGGGTGGAGGGGCGGGGCCCATGGGAGAAAAAGCCGGGTTGGTGGATAACATTTATGGAAAAAAGAAAGAGAGGCCACACCCGCCGGGGCAAAAACACTTCAGGACGCAGCCGGGGGGGAAGTCCCGCCGAGGGGGATAGGTGTGGGGGATTGAGAAGTATGGTATTGGATGTGAATGAAGGNNAGAGGGGAGGGGAAAGAGAAGAGGGCGGGGCGCGTGGGAGAAGGGGGGAGTCGGGGAAGAGGGAAGGGAGCGGGAGGAGNAGGCGGGCAGGGGGGGGGGGTGCGGGAGGGGGGAGGTGAGGGAAGAACTGGGGAGAGGGGAGAGAGAGGGGGGAAGGGCGTGGGAGGAAGGGAGGGGGAAGAAGGGGGGAGGGCGTGGGTGAGGAGGTGGGGGGGGGGAGGAGAAAGGGGGGAGGGGGNAGAAGGCGGGGGAGGGGAGAGAGN
Full Trace Sequence: GGGAAAACGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAANAAAGTTGGCAAGCTCTTGCTGGAATTCTCTGCGTTTGGCCTAATGAGACGGGGGCGTCCTCTTCGCCGTGGCGGTGGACTGGCAACCTCAGGGGCTTTGGTTGGGGAAGCATCATTACTGGTGGGTTTCCGTCAAACATGGTGGCAACTTTTTTGTAGGAAGTTCGCATTATAANAAAGCATTTCTCCGCAATTTCTTGCGGCGGAGAGGGCGCTATCAGTCAAAGGAAGAAGGGTAGGTTGGGAGGGGAGTTCGGAACTAGANCNGGNCCAGAAAAAAAAAAAAGAAAAGATTAACATCGCGTGCTCTGGAAAGCGGGGGGACAAAAAAATAAAAGGCTCTGCCGACCAAGGGGGGGTGGTGGGTGAGATCGTGGGGATGGGTGGAGGGGCGGGGCCCATGGGAGAAAAAGCCGGGTTGGTGGATAACATTTATGGAAAAAAGAAAGAGAGGCCACACCCGCCGGGGCAAAAACACTTCAGGACGCAGCCGGGGGGGAAGTCCCGCCGAGGGGGATAGGTGTGGGGGATTGAGAAGTATGGTATTGGATGTGAATGAAGGNNAGAGGGGAGGGGAAAGAGAAGAGGGCGGGGCGCGTGGGAGAAGGGGGGAGTCGGGGAAGAGGGAAGGGAGCGGGAGGAGNAGGCGGGCAGGGGGGGGGGGTGCGGGAGGGGGGAGGTGAGGGAAGAACTGGGGAGAGGGGAGAGAGAGGGGGGAAGGGCGTGGGAGGAAGGGAGGGGGAAGAAGGGGGGAGGGCGTGGGTGAGGAGGTGGGGGGGGGGAGGAGAAAGGGGGGAGGGGGNAGAAGGCGGGGGAGGGGAGAGAGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTCTTGCTGGAATTCTCT