ORFeome > MGC115708 ORF1 – XORFeome v1.0

MGC115708 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6255592
Gene Page ID:
ORF Xenbase ID: 17257221

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097909
Original XGC clone length: 612

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ838375
dbEST ID: 79656077
Trimmed Sequence: ATGTTCCGCAGCCTGGGGCTCCTGCTGTGCCTGGCCTCTCTCACTCTGCACATTAGAGGTCAAGATGACTTTGATCTAAAACAAGTTTTCGATGATGATGTTGTCGATGTAACTAAAAAAACACCTGCTGCTCCCACCAAACCTGTGGATGGACCCCCAAAAGCAACTCCAAAACCAAACCCAGGTGGTGCTGGGATTGAGGATTTTAATCTTGGCGATGCATTTGACAATGGCGATAAAGGCCCTGAAACTCCCAAGCCTCAGCCTAAGCCTCAGCCTGGTGGTGGTGGAGGAGCAGGTGGTGGTGGAGGACATATCAGCGACAACGATCTTGTTGATGGCCAACCTTTACCCGATGACCCCAAAGACCGTGACTATCATCCATCCGCTGACACAGAAGAAAAGCCAGTAGAAGAACCAAAAACCAGCATGATTGCTGGAATACTGGGCGCAGTTGGTGCAGCTGCTTTGGGGGCAGTATCAAGCTTTATAGCTTACCAGAAGAAGAAACTGTGCTTCAAAGAATCAAGCGGTGACCCAGAAAATGTAAACATGGAAAGCTATAAAGGGGATCAAGCAGAGCCACAAGTTCAACCCTTCCTCGCCCAATT
Full Trace Sequence: CCGGGGGCCAAATAATGGATTTTATTNTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTCCGCAGCCTGGGGCTCCTGCTGTGCCTGGCCTCTCTCACTCTGCACATTAGAGGTCAAGATGACTTTGATCTAAAACAAGTTTTCGATGATGATGTTGTCGATGTAACTAAAAAAACACCTGCTGCTCCCACCAAACCTGTGGATGGACCCCCAAAAGCAACTCCAAAACCAAACCCAGGTGGTGCTGGGATTGAGGATTTTAATCTTGGCGATGCATTTGACAATGGCGATAAAGGCCCTGAAACTCCCAAGCCTCAGCCTAAGCCTCAGCCTGGTGGTGGTGGAGGAGCAGGTGGTGGTGGAGGACATATCAGCGACAACGATCTTGTTGATGGCCAACCTTTACCCGATGACCCCAAAGACCGTGACTATCATCCATCCGCTGACACAGAAGAAAAGCCAGTAGAAGAACCAAAAACCAGCATGATTGCTGGAATACTGGGCGCAGTTGGTGCAGCTGCTTTGGGGGCAGTATCAAGCTTTATAGCTTACCAGAAGAAGAAACTGTGCTTCAAAGAATCAAGCGGTGACCCAGAAAATGTAAACATGGAAAGCTATAAAGGGGATCAAGCAGAGCCACAAGTTCAACCCTTCCTCGCCCAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACAAACAGGTCACTATCAATCAAAATAAAATCATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCCGCAGCCTGGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838374
dbEST ID: 79656076
Trimmed Sequence: TTTGGCGAGGAAGGGTTGAACTTGTGGCTCTGCTTGATCCCCTTTATAGCTTTCCATGTTTACATTTTCTGGGTCACCGCTTGATTCTTTGAAGCACAGTTTCTTCTTCTGGTAAGCTATAAAGCTTGATACTGCCCCCAAAGCAGCTGCACCAACTGCGCCCAGTATTCCAGCAATCATGCTGGTTTTTGGTTCTTCTACTGGCTTTTCTTCTGTGTCAGCGGATGGATGATAGTCACGGTCTTTGGGGTCATCGGGTAAAGGTTGGCCATCAACAAGATCGTTGTCGCTGATATGTCCTCCACCACCACCTGCTCCTCCACCACCACCAGGCTGAGGCTTAGGCTGAGGCTTGGGAATTTCAGGGCCTTTATCGCCATTGTCAAATGCATCGCCCAGATTAAAATCCTCAATCCCAGCACCACCTGGGTTTGGTTTTGGAGTTGCTTTTGGGGGTCCATCCACAGGTTTGGTGGGAACAACAGGTGTTTTTTTAATTACATCAACAACCTCATCCATCAAAACTTGGTTTAGATTCAAGTCATCTGGACCTCTGATGGTGCAGAGTGAGAGAGGCCCAGGCACAGGAAGGAGCCCCAGGCTGCGGAACATGGGTGCCAAGTTTTTTGAACAAAATTTGGCATTATGAAAAACCCATGGCTCACCAATTC
Full Trace Sequence: CGGGGAAACGTCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTGGCGAGGAAGGGTTGAACTTGTGGCTCTGCTTGATCCCCTTTATAGCTTTCCATGTTTACATTTTCTGGGTCACCGCTTGATTCTTTGAAGCACAGTTTCTTCTTCTGGTAAGCTATAAAGCTTGATACTGCCCCCAAAGCAGCTGCACCAACTGCGCCCAGTATTCCAGCAATCATGCTGGTTTTTGGTTCTTCTACTGGCTTTTCTTCTGTGTCAGCGGATGGATGATAGTCACGGTCTTTGGGGTCATCGGGTAAAGGTTGGCCATCAACAAGATCGTTGTCGCTGATATGTCCTCCACCACCACCTGCTCCTCCACCACCACCAGGCTGAGGCTTAGGCTGAGGCTTGGGAATTTCAGGGCCTTTATCGCCATTGTCAAATGCATCGCCCAGATTAAAATCCTCAATCCCAGCACCACCTGGGTTTGGTTTTGGAGTTGCTTTTGGGGGTCCATCCACAGGTTTGGTGGGAACAACAGGTGTTTTTTTAATTACATCAACAACCTCATCCATCAAAACTTGGTTTAGATTCAAGTCATCTGGACCTCTGATGGTGCAGAGTGAGAGAGGCCCAGGCACAGGAAGGAGCCCCAGGCTGCGGAACATGGGTGCCAAGTTTTTTGAACAAAATTTGGCATTATGAAAAACCCATGGCTCACCAATTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGGCGAGGAAGGGTTGA