ORFeome > MGC115736 ORF1 – XORFeome v1.0

MGC115736 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5727097
Gene Page ID: 5727064
ORF Xenbase ID: 17257233

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099067
Original XGC clone length: 1305

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: D06

Sequences - 5ʹ (forward) EST

Accession: JZ838365
dbEST ID: 79656067
Trimmed Sequence: ATGTCGCACAATTCCTTAAAAATGCCAGCCATTCAATGGCTTCAGCTTCCTCAGGAGATCCTTCTGGACATATTCACGTACCTTTCGCCGTCCGAAAAGGCAAATGTTCGGGCTACGTGCACTTATTTACGGACCCTGGTTGACCATCCATCTTTATGGAAAAACAGTACAATTCTTTTTAGAAGTATAGGAATATTCAATGCTAAATTCTGGGACATGCTTCAAAGCCGAAAGATCTGCTCCGTGGAGGTGACCAAAGTAACTCTGAAGCAGTTTAAGAAGATGACCCTTTCATTGCCTGATCTTACCACAGTCACAATGGACTCCTGTTTGAAAGGAGAGATCCTCCAGGGGCTAAGACCACTTGTGAACCTGAAACGGTTGCATTTGACAGACTGTTCTCATGTGTCGGACCATGATATATTTTCAGAAATTGTTAATTTTCAGCAACTTACACATTTATCTTTATGCAAAGTGTTTTTCTCCAATGCCCTCCCATTGACTAGCATTGTTTTACTTCAAAACCTCTATTCCCTTTCTCTTCATTCAAAAGACGGCATTGTGCCTGAAAGGGCTCTACAATATATCCTTTTTAGACTACCAAAACTTCAAGAACTTTCCCTGGCAGTTGGCAATATGAATAAATGGAAGCTGTCTCTGTGTTTTAATAGGCCAGAACAATTTATATTGGCAGCTGATGAAATACCTTGTATCCAAAGACTGCAACTCCAGAAACTGGAAACTGCTAA
Full Trace Sequence: GGGGCGCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGCACAATTCCTTAAAAATGCCAGCCATTCAATGGCTTCAGCTTCCTCAGGAGATCCTTCTGGACATATTCACGTACCTTTCGCCGTCCGAAAAGGCAAATGTTCGGGCTACGTGCACTTATTTACGGACCCTGGTTGACCATCCATCTTTATGGAAAAACAGTACAATTCTTTTTAGAAGTATAGGAATATTCAATGCTAAATTCTGGGACATGCTTCAAAGCCGAAAGATCTGCTCCGTGGAGGTGACCAAAGTAACTCTGAAGCAGTTTAAGAAGATGACCCTTTCATTGCCTGATCTTACCACAGTCACAATGGACTCCTGTTTGAAAGGAGAGATCCTCCAGGGGCTAAGACCACTTGTGAACCTGAAACGGTTGCATTTGACAGACTGTTCTCATGTGTCGGACCATGATATATTTTCAGAAATTGTTAATTTTCAGCAACTTACACATTTATCTTTATGCAAAGTGTTTTTCTCCAATGCCCTCCCATTGACTAGCATTGTTTTACTTCAAAACCTCTATTCCCTTTCTCTTCATTCAAAAGACGGCATTGTGCCTGAAAGGGCTCTACAATATATCCTTTTTAGACTACCAAAACTTCAAGAACTTTCCCTGGCAGTTGGCAATATGAATAAATGGAAGCTGTCTCTGTGTTTTAATAGGCCAGAACAATTTATATTGGCAGCTGATGAAATACCTTGTATCCAAAGACTGCAACTCCAGAAACTGGAAACTGCTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGCACAATTCCTTAAAAATG

Sequences - 3ʹ (reverse) EST

Accession: JZ838364
dbEST ID: 79656066
Trimmed Sequence: CCAGCAGCAGTATTGTGCATTCTCACTTGGCTTGTTAAGTATTAAAGAAACTCTGTTGCATGTAATCTTTTTGAAAGCAAGTATGGCTTCTGGAGTCAAATGCTGATTGTTTGAGATATCAAGTACTCGCAGAGAGTACAGGTTGGCCAACACCACTAATGCTTCTTCTGTCAGCCTGGCATTACTGAGGTAGAGATTTTGCAGTTTGGGAAATAACCGAGGGAAACGTTTAATGATCTCTTCATCATATCCATGTGAAAAGCTCAAGTTCAGGCACTTTAATTCACTGGTACTCTGAGAGATGCATTTTAAAGTTGCATTGCAAATCTTTGTTCCCACCACACTCAACTTTTCTAATTTTGAAGTGATGGGTCCCAAAAATGGTTCAAAGGGAGCAGCCCATTCAACCTTGAGCTCAACCAGGTTAGGGAGCTTGATGAATATAGCTTCAATGAAGTCTTCATGCTGCAAGTATTTGTAATGCCGTAGACAAACGGAGGTAAGAGTAGACAGCTGATCAAATGCATTAGCCGAGAGACTTGCACAGCTCGAATTTAGCAGTTCCAGTTTCTGGAGTTGCAGTCTTTGGATACAAGGTATTTCATCAGCTGCCAATATAAAAATGTCTGGGCTATTAAAACACAAAGACAGCTTCCATTTATTCATATTGCCAACTGCCCAGGGAAAGTTTCTGAAGTTTTTGGTAATTCTAAAAAGGAAAATAGTGGAAAAAG
Full Trace Sequence: AAAAAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCAGCAGCAGTATTGTGCATTCTCACTTGGCTTGTTAAGTATTAAAGAAACTCTGTTGCATGTAATCTTTTTGAAAGCAAGTATGGCTTCTGGAGTCAAATGCTGATTGTTTGAGATATCAAGTACTCGCAGAGAGTACAGGTTGGCCAACACCACTAATGCTTCTTCTGTCAGCCTGGCATTACTGAGGTAGAGATTTTGCAGTTTGGGAAATAACCGAGGGAAACGTTTAATGATCTCTTCATCATATCCATGTGAAAAGCTCAAGTTCAGGCACTTTAATTCACTGGTACTCTGAGAGATGCATTTTAAAGTTGCATTGCAAATCTTTGTTCCCACCACACTCAACTTTTCTAATTTTGAAGTGATGGGTCCCAAAAATGGTTCAAAGGGAGCAGCCCATTCAACCTTGAGCTCAACCAGGTTAGGGAGCTTGATGAATATAGCTTCAATGAAGTCTTCATGCTGCAAGTATTTGTAATGCCGTAGACAAACGGAGGTAAGAGTAGACAGCTGATCAAATGCATTAGCCGAGAGACTTGCACAGCTCGAATTTAGCAGTTCCAGTTTCTGGAGTTGCAGTCTTTGGATACAAGGTATTTCATCAGCTGCCAATATAAAAATGTCTGGGCTATTAAAACACAAAGACAGCTTCCATTTATTCATATTGCCAACTGCCCAGGGAAAGTTTCTGAAGTTTTTGGTAATTCTAAAAAGGAAAATAGTGGAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCAGCAGCAGTATTGTGCATT