ORFeome > MGC116437 ORF1 – XORFeome v1.0

MGC116437 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 973585
Gene Page ID: 973578
ORF Xenbase ID: 17257245

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099252
Original XGC clone length: 708

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ840156
dbEST ID: 79657858
Trimmed Sequence: ATGAACAACAAATTCGATGCTCTTAAAGATGATGACAGTGGGGATCATGATCAGAACGAAGAAAACGGCACACAGAAAGACAGTGAGAAGGAAAAAAATGACGACAAGGAGAAAAACCAAGGCTCTTCTAGGAAAAAGAGTGTTGTGCCAGGTCCAGCCGAGCACCCCTTACAGTACAACTACACATTCTGGTACTCGCGCAGAACTCCGGGAAGGCCAACCAGCTCCCAGAGCTATGAGCAGAACATTAAACAGATCGGTACCTTCGCTTCTGTGGAACAATTTTGGAGGTTCTATAGTCACATGGTACGACCTGGGGACCTGACTGGGCACAGTGATTTTCACCTCTTCAAGGAAGGGATCAAACCAATGTGGGAGGATGATGCAAACAAAAATGGAGGAAAGTGGATAATTCGCCTTCGCAAAGGTCTAGCATCACGATGCTGGGAGAATCTCATACTGGCCATGTTGGGAGAGCAGTTCATGGTTGGAGAGGAGATCTGTGGAGCTGTTGTCTCTGTTCGTTTCCAGGAAGACATCATATCCATTTGGAACAAGACTGCAAGTGATCANGCAACCACTGCTCGTATCCGAGACACATTGCGCCCGAGTCCTGAATTTGCCTCCCAACCTGTTATGGAATACAAAACGCACACAGACCGCATCAAGGACAAACAAGCCTCAGAAATACCCAAATTGCTTTGTTGCCAACTTTCTTGTAAAAAGTTTGGATTTAAAAAAAGCATTGGCTTATCCAATTTGTTGGCAACAAAAAGGGTCACTATCAAATCAAAATAAAAAATCATTA
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACAACAAATTCGATGCTCTTAAAGATGATGACAGTGGGGATCATGATCAGAACGAAGAAAACGGCACACAGAAAGACAGTGAGAAGGAAAAAAATGACGACAAGGAGAAAAACCAAGGCTCTTCTAGGAAAAAGAGTGTTGTGCCAGGTCCAGCCGAGCACCCCTTACAGTACAACTACACATTCTGGTACTCGCGCAGAACTCCGGGAAGGCCAACCAGCTCCCAGAGCTATGAGCAGAACATTAAACAGATCGGTACCTTCGCTTCTGTGGAACAATTTTGGAGGTTCTATAGTCACATGGTACGACCTGGGGACCTGACTGGGCACAGTGATTTTCACCTCTTCAAGGAAGGGATCAAACCAATGTGGGAGGATGATGCAAACAAAAATGGAGGAAAGTGGATAATTCGCCTTCGCAAAGGTCTAGCATCACGATGCTGGGAGAATCTCATACTGGCCATGTTGGGAGAGCAGTTCATGGTTGGAGAGGAGATCTGTGGAGCTGTTGTCTCTGTTCGTTTCCAGGAAGACATCATATCCATTTGGAACAAGACTGCAAGTGATCANGCAACCACTGCTCGTATCCGAGACACATTGCGCCCGAGTCCTGAATTTGCCTCCCAACCTGTTATGGAATACAAAACGCACACAGACCGCATCAAGGACAAACAAGCCTCAGAAATACCCAAATTGCTTTGTTGCCAACTTTCTTGTAAAAAGTTTGGATTTAAAAAAAGCATTGGCTTATCCAATTTGTTGGCAACAAAAAGGGTCACTATCAAATCAAAATAAAAAATCATTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACAACAAATTCGATGCTCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ840155
dbEST ID: 79657857
Trimmed Sequence: CAAAGCAATTTTGGTATTTCTGAAGCTTGTTTTGTCCTTGATGCTGTCTGTGTGCGTTTTGTATTCCATAACAGTGTTGGGAGGCAAATTCAGGACTCGGCGCAATGTGTCTCGGATACGAGCAGTGGTTGCCTGATCACTTGCAGTCTTGTTCCAAATGGATATGATGTCTTCCTGGAAACGAACAGAGACAACAGCTCCACAGATCTCCTCTCCAACCATGAACTGCTCTCCCAACATGGCCAGTATGAGATTCTCCCAGCATCGTGATGCTAGACCTTTGCGAAGGCGAATTATCCACTTTCCTCCATTTTTGTTTGCATCATCCTCCCACATTGGTTTGATCCCTTCCTTGAAGAGGTGAAAATCACTGTGCCCAGTCAGGTCCCCAGGTCGTACCATGTGACTATAGAACCTCCAAAATTGTTCCACAAAAGCGAAGGTACCGATCTGTTTAATGTTCTGCTCATAGCTCTGGGAGCTGGTTGGCCTTCCCGGAATTCTGCGCGAGTACCAAAATGTGTAGTTGTACTGTAAGGGGTGCTCGGCTGGACCTGGCACAACACTCTTTTTCCTAAAAGAACCTTGGTTTTTCTCCTTGTCGTCATTTTTTTCCTTCTAATTGTCTTTCTGTGTCCCGTTTTCTTCGTTCTAATCATGATCCCCCCTGTCATCCTCTTTAAAAAACATCAAAATTTTTTGTTCATGGGGCCCCACTTTTTTGGGAACAAAGGTTGGGCAATAAAAAAAAAAACCATGTGCCTTAACAAA
Full Trace Sequence: GAGGACAAGGCTTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAAGCAATTTTGGTATTTCTGAAGCTTGTTTTGTCCTTGATGCTGTCTGTGTGCGTTTTGTATTCCATAACAGTGTTGGGAGGCAAATTCAGGACTCGGCGCAATGTGTCTCGGATACGAGCAGTGGTTGCCTGATCACTTGCAGTCTTGTTCCAAATGGATATGATGTCTTCCTGGAAACGAACAGAGACAACAGCTCCACAGATCTCCTCTCCAACCATGAACTGCTCTCCCAACATGGCCAGTATGAGATTCTCCCAGCATCGTGATGCTAGACCTTTGCGAAGGCGAATTATCCACTTTCCTCCATTTTTGTTTGCATCATCCTCCCACATTGGTTTGATCCCTTCCTTGAAGAGGTGAAAATCACTGTGCCCAGTCAGGTCCCCAGGTCGTACCATGTGACTATAGAACCTCCAAAATTGTTCCACAAAAGCGAAGGTACCGATCTGTTTAATGTTCTGCTCATAGCTCTGGGAGCTGGTTGGCCTTCCCGGAATTCTGCGCGAGTACCAAAATGTGTAGTTGTACTGTAAGGGGTGCTCGGCTGGACCTGGCACAACACTCTTTTTCCTAAAAGAACCTTGGTTTTTCTCCTTGTCGTCATTTTTTTCCTTCTAATTGTCTTTCTGTGTCCCGTTTTCTTCGTTCTAATCATGATCCCCCCTGTCATCCTCTTTAAAAAACATCAAAATTTTTTGTTCATGGGGCCCCACTTTTTTGGGAACAAAGGTTGGGCAATAAAAAAAAAAACCATGTGCCTTAACAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAAGCAATTTTGGTATTTCT