ORFeome > MGC116444 ORF1 – XORFeome v1.0

MGC116444 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 6078502
Gene Page ID: 993820
ORF Xenbase ID: 17257257

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099280
Original XGC clone length: 810

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ840152
dbEST ID: 79657854
Trimmed Sequence: ATGACTTCTACTGCTCCTCTCCTCTTGGCTTTAGCTGCTCTGTTTGGCAGGAGTTATGGTCAGTCTGCTACCCAACCTGAAACTCACCGCTCTGTTCTCCAAGGAGAAGCTGTACAGCTCAACTGTACATATAAGACAGCTGTTAATATGTTCTGGTATGTTCAGTATCCAGATAAAGCTCTGGAGATGCTGCTGTATAATTATGGAGAAGAAATTAAGAAAGGATTCACAGCTAAAGATGAGAAATCAGATTCTACCTACAACCTACGTAAAGAAGCAGCAGAACTGAGAGACTCTGGGGTGTATTTCTGTGCAGTGAGTGATAATAATGCCAAACTCACTTTTGGAAGTGGAACCAGTTTAAGAGTTTTACCAAACATTAAAGATGCTAAACCTTCAATGTATCGCCTCAAAGCTGACACGAATGAACCAGGAGTCCCTGAATCTGTGTGCCTGGTCACTGATTTCCCAGTTCTTAGTAATGAAACAGAGCTCCAACTGAATGGAATAAAGGTGAACAAAGATGAAAGACTATTGTTGGACAAAACTGAAGACAACACATGGAGATACAGTTCAGTCCTGTGGAATGATGATGCAAAAACAAAATGCACAGTGAATTATGCAAGCAACAAAATTTCTGAAATACCCGTAGCAGAGAAAATTGAATGTTCATCGCCCAAAATTGATGAGACCCTTTAAAACAAAATAAAGAATGAATAACGTAATCTCTCAAAATGGCTTGGAACTGAAGGTTCTTAA
Full Trace Sequence: TCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTTCTACTGCTCCTCTCCTCTTGGCTTTAGCTGCTCTGTTTGGCAGGAGTTATGGTCAGTCTGCTACCCAACCTGAAACTCACCGCTCTGTTCTCCAAGGAGAAGCTGTACAGCTCAACTGTACATATAAGACAGCTGTTAATATGTTCTGGTATGTTCAGTATCCAGATAAAGCTCTGGAGATGCTGCTGTATAATTATGGAGAAGAAATTAAGAAAGGATTCACAGCTAAAGATGAGAAATCAGATTCTACCTACAACCTACGTAAAGAAGCAGCAGAACTGAGAGACTCTGGGGTGTATTTCTGTGCAGTGAGTGATAATAATGCCAAACTCACTTTTGGAAGTGGAACCAGTTTAAGAGTTTTACCAAACATTAAAGATGCTAAACCTTCAATGTATCGCCTCAAAGCTGACACGAATGAACCAGGAGTCCCTGAATCTGTGTGCCTGGTCACTGATTTCCCAGTTCTTAGTAATGAAACAGAGCTCCAACTGAATGGAATAAAGGTGAACAAAGATGAAAGACTATTGTTGGACAAAACTGAAGACAACACATGGAGATACAGTTCAGTCCTGTGGAATGATGATGCAAAAACAAAATGCACAGTGAATTATGCAAGCAACAAAATTTCTGAAATACCCGTAGCAGAGAAAATTGAATGTTCATCGCCCAAAATTGATGAGACCCTTTAAAACAAAATAAAGAATGAATAACGTAATCTCTCAAAATGGCTTGGAACTGAAGGTTCTTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTTCTACTGCTCCTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ840151
dbEST ID: 79657853
Trimmed Sequence: AGCTGACCAGAGTCGTTGCGTTGTTATCGCATTGAACACTATGGCTTTGATGGTTAAGAACCTCAGTCCAAGCATTTTGAGAGATACTGTATTCAGTCTTTCATCTGTTTTAAAGGTCTCATCAATTTTTGGCGATGAACATTCAATTTTCTCTGCTACGGGTATTTCAGAAATTTTGTTGCTTGCATAATTCACTGTGCATTCTGTTTTTGCATCATCATTCCACAGGACTGAACTGTATCTCCATGTGTTGTCTTCAGTTTTGTCCAACAATAGTCTTTCATCTTTGTTCACCTTTATTCCATTCAGTTGGAGCTCTGTTTCATTACTAAGAACTGGGAAATCAGTGACCAGGCACACAGATTCAGGGACTCCTGGTTCATTCGTGTCAGCTTTGAGGCGATACATTGAAGGTTTAGCATCTTTAATGTTTGGTAAAACTCTTAAACTGGTTCCACTTCCAAAAGTGAGTTTGGCATTATTATCACTCACTGCACAGAAATACACCCCAGAGTCTCTCAGTTCTGCTGCTTCTTTACGTAGGTTGTAGGTAGAATCTGATTTCTCATCTTTAGCTGTGAATCCTTTTCTAATTTCTTCTTCCTAATTATACCGCACCATCTCCGGAGCTTTATCCGGATACGGAACATACCAAAACAATTAAACAGCTGGCCTAAATGTACCGTTTGAAGCTGTACGGCTCCCCCTTGGAAAAAACAAGCGGGGGAGTTTCAAGGTGGGGAAACCAAAAATGACCCTAAACCTCCCGCGCCA
Full Trace Sequence: GGCAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCTGACCAGAGTCGTTGCGTTGTTATCGCATTGAACACTATGGCTTTGATGGTTAAGAACCTCAGTCCAAGCATTTTGAGAGATACTGTATTCAGTCTTTCATCTGTTTTAAAGGTCTCATCAATTTTTGGCGATGAACATTCAATTTTCTCTGCTACGGGTATTTCAGAAATTTTGTTGCTTGCATAATTCACTGTGCATTCTGTTTTTGCATCATCATTCCACAGGACTGAACTGTATCTCCATGTGTTGTCTTCAGTTTTGTCCAACAATAGTCTTTCATCTTTGTTCACCTTTATTCCATTCAGTTGGAGCTCTGTTTCATTACTAAGAACTGGGAAATCAGTGACCAGGCACACAGATTCAGGGACTCCTGGTTCATTCGTGTCAGCTTTGAGGCGATACATTGAAGGTTTAGCATCTTTAATGTTTGGTAAAACTCTTAAACTGGTTCCACTTCCAAAAGTGAGTTTGGCATTATTATCACTCACTGCACAGAAATACACCCCAGAGTCTCTCAGTTCTGCTGCTTCTTTACGTAGGTTGTAGGTAGAATCTGATTTCTCATCTTTAGCTGTGAATCCTTTTCTAATTTCTTCTTCCTAATTATACCGCACCATCTCCGGAGCTTTATCCGGATACGGAACATACCAAAACAATTAAACAGCTGGCCTAAATGTACCGTTTGAAGCTGTACGGCTCCCCCTTGGAAAAAACAAGCGGGGGAGTTTCAAGGTGGGGAAACCAAAAATGACCCTAAACCTCCCGCGCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCTGACCAGAGTCGTTGCGTT