ORFeome > MGC116490 ORF1 – XORFeome v1.0

MGC116490 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6255567
Gene Page ID:
ORF Xenbase ID: 17257287

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC099298
Original XGC clone length: 492

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11007
Well Location: B03

Sequences - 5ʹ (forward) EST

Accession: JZ840124
dbEST ID: 79657826
Trimmed Sequence: ATGGTGGATAAGATGGAACATGACATGAAAACAAGCCAGAGACACATTAACAGTATAAAGAGTATGTTTAGTGGATTCACAAACTACTTTAGGTCAAAACCAGCTGAAACACCCCCTGAGAATGAAGAAACTGAATATCAATCAAGTACAAAACTAGCAGAAGCTATGTCGAGCAGCAAAGCACAGGAAGAGAACTATCAAGCTGCACATCCCAACCTGCTTAAGAGAGAAATTTTAGAGTCAAGCAATAATACAGGAGCATCCAGCTCAGAAAATCAACACAAGAACCAGGTGTTAAGAAGTTATCACCAGAAAGTCGACAATAATTTGGATGACATGTCTTTAGGTTTAAGTCGACTGAAAAACCTTGCGCTAGGACTGCAGACAGAAATCGATGACCAGGATGATATGCTTGGGCGCCTGACCAACAAAGTAGATAAGATGGACTTAAACATCAAGACCACAGACAAGCGGGTCCGTGAAGAGCTATT
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGGATAAGATGGAACATGACATGAAAACAAGCCAGAGACACATTAACAGTATAAAGAGTATGTTTAGTGGATTCACAAACTACTTTAGGTCAAAACCAGCTGAAACACCCCCTGAGAATGAAGAAACTGAATATCAATCAAGTACAAAACTAGCAGAAGCTATGTCGAGCAGCAAAGCACAGGAAGAGAACTATCAAGCTGCACATCCCAACCTGCTTAAGAGAGAAATTTTAGAGTCAAGCAATAATACAGGAGCATCCAGCTCAGAAAATCAACACAAGAACCAGGTGTTAAGAAGTTATCACCAGAAAGTCGACAATAATTTGGATGACATGTCTTTAGGTTTAAGTCGACTGAAAAACCTTGCGCTAGGACTGCAGACAGAAATCGATGACCAGGATGATATGCTTGGGCGCCTGACCAACAAAGTAGATAAGATGGACTTAAACATCAAGACCACAGACAAGCGGGTCCGTGAAGAGCTATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTATTTCCTGGCAGCTCTGGCCCGTGTCTCAAACTCCTGTATGGTTCAAGNGGGCCGGGGNNNNNTGTGTGGCGCGGGGGGGTGCGGGGGGCGGGCCCCTTGGGTTTTGTGGTTGGGTGGTGCCGGGGCCCCCTCCCGCGTGTGGGGTGTTCTCCGCGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGATAAGATGGAACATGA

Sequences - 3ʹ (reverse) EST

Accession: JZ840123
dbEST ID: 79657825
Trimmed Sequence: TAGCTCTTCACGGACCCGCTTGTCTGTGGTCTTGATGTTTAAGTCCATCTTATCTACTTTGTTGGTCAGGCGCCCAAGCATATCATCCTGGTCATCGATTTCTGTCTGCAGTCCTAGCGCAAGGTTTTTCAGTCGACTTAAACCTAAAGACATGTCATCCAAATTATTGTCGACTTTCTGGTGATAACTTCTTAACACCTGGTTCTTGTGTTGATTTTCTGAGCTGGATGCTCCTGTATTATTGCTTGACTCTAAAATTTCTCTCTTAAGCAGGTTGGGATGTGCAGCTTGATAGTTCTCTTCCTGTGCTTTGCTGCTCGACATAGCTTCTGCTAGTTTTGTACTTGATTGATATTCAGTTTCTTCATTCTCAGGGGGTGTTTCAGCTGGTTTTGACCTAAAGTAGTTTGTGAATCCACTAAACATACTCTTTATACTGTTAATGTGTCTCTGGCTTGTTTTCATGTCATGTTCCATCTTATCCACCATGG
Full Trace Sequence: GAGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAGCTCTTCACGGACCCGCTTGTCTGTGGTCTTGATGTTTAAGTCCATCTTATCTACTTTGTTGGTCAGGCGCCCAAGCATATCATCCTGGTCATCGATTTCTGTCTGCAGTCCTAGCGCAAGGTTTTTCAGTCGACTTAAACCTAAAGACATGTCATCCAAATTATTGTCGACTTTCTGGTGATAACTTCTTAACACCTGGTTCTTGTGTTGATTTTCTGAGCTGGATGCTCCTGTATTATTGCTTGACTCTAAAATTTCTCTCTTAAGCAGGTTGGGATGTGCAGCTTGATAGTTCTCTTCCTGTGCTTTGCTGCTCGACATAGCTTCTGCTAGTTTTGTACTTGATTGATATTCAGTTTCTTCATTCTCAGGGGGTGTTTCAGCTGGTTTTGACCTAAAGTAGTTTGTGAATCCACTAAACATACTCTTTATACTGTTAATGTGTCTCTGGCTTGTTTTCATGTCATGTTCCATCTTATCCACCATGGTGCCAACTTTTTTGTACCAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAAACAGTCACTATCAGTCAAAATAAAATCATTATTTGAGAACAAAGTTTATAACTGATCATGTTTACTAGGATTTGAACTTGGCTTTTTCCCTAAAGGCTCTCCCGGATAATGCACAATCCATTTGATTTTAACATGACCGGGAGGCTTACCGGATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGCTCTTCACGGACCCGCTT