ORFeome > MGC116521 ORF1 – XORFeome v1.0

MGC116521 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5761468
Gene Page ID: 5761425
ORF Xenbase ID: 17257311

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099327
Original XGC clone length: 714

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11007
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ840146
dbEST ID: 79657848
Trimmed Sequence: ATGGCAAGATATGTCCTGTGGTTTGTCTTCGTCGCCGGATCTCTTGCGGCAGAAGATTTAGGAGGAAAGGTCTTTCTTTTTCCCAAGGCCACAGATACAGCCCGTGTGATTCTAAAGCCTATGATAACAAAGAGAGTAGAGAGTGTAACTGTTTGCCTGGAATCCTACACAGCCTTCACTCGAGAACATTCTCTTTTCTCTTTGGCCGTGCCGGGGATGGACAATGCTCTTCTCATCTACTCAGAGCCACCAAACAGGTATCAGTTGTTTGTAAACCAAGAATCTTATAATTTCCAAGTAAACCCAGAGGTTTTGGACTGGAAACATACCTGTGTAAGCTGGGAATCTGAGTCGGGTGTGGTTCAGCTCTGGATCAATGGAAAACTGTATCCCAGAACTGTTATGAAGAAGACGTCACTGATTGATATTGAGGCCAGTATAATCCTGGGACAGGAACAAGATTCATATGGTGGCAAATTTGATATCCAACAGTGTTTTGTGGGCGAGATAACCAACGTACACATGTGGGATTATGTACTGACCCAGGAAGAGATACAGAAGGTTCTGGCTGGAAAAAAAGATATGAATGGCAACATTATTAACTGGAGATCATTGCAGTATGAGATAAAAGGAGATGTGGTTGTCCAGCCCCAGCTACCATGCCCAATCTCTAGGGAATAATTATAACTTTGCATTCTGTGTGCTATGAAAATTTGGCCAACTTTCTTTGTAACAAGTTTGGGCATTAATAGAAAAA
Full Trace Sequence: TCGAGGGCCCAATAAGTGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAAGATATGTCCTGTGGTTTGTCTTCGTCGCCGGATCTCTTGCGGCAGAAGATTTAGGAGGAAAGGTCTTTCTTTTTCCCAAGGCCACAGATACAGCCCGTGTGATTCTAAAGCCTATGATAACAAAGAGAGTAGAGAGTGTAACTGTTTGCCTGGAATCCTACACAGCCTTCACTCGAGAACATTCTCTTTTCTCTTTGGCCGTGCCGGGGATGGACAATGCTCTTCTCATCTACTCAGAGCCACCAAACAGGTATCAGTTGTTTGTAAACCAAGAATCTTATAATTTCCAAGTAAACCCAGAGGTTTTGGACTGGAAACATACCTGTGTAAGCTGGGAATCTGAGTCGGGTGTGGTTCAGCTCTGGATCAATGGAAAACTGTATCCCAGAACTGTTATGAAGAAGACGTCACTGATTGATATTGAGGCCAGTATAATCCTGGGACAGGAACAAGATTCATATGGTGGCAAATTTGATATCCAACAGTGTTTTGTGGGCGAGATAACCAACGTACACATGTGGGATTATGTACTGACCCAGGAAGAGATACAGAAGGTTCTGGCTGGAAAAAAAGATATGAATGGCAACATTATTAACTGGAGATCATTGCAGTATGAGATAAAAGGAGATGTGGTTGTCCAGCCCCAGCTACCATGCCCAATCTCTAGGGAATAATTATAACTTTGCATTCTGTGTGCTATGAAAATTTGGCCAACTTTCTTTGTAACAAGTTTGGGCATTAATAGAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAAGATATGTCCTGTGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ840145
dbEST ID: 79657847
Trimmed Sequence: ATTTTCATAGCACACAGAATGCAAGTTATAATTATTCCCTAGAGATCGGCATTGTAGCTGGGGCTGGACAACCACATCTCCTTTTATCTCATACTGCAATGATCTCCAGTTAATAATGTTGCCATTCATATCTTTTTTTCCAGCCAGAACCTTCTGTATTTCTTCCTGGGTCAGTACATAATCCCACATGTGTACGTTGGTTATCTCGCCCACAAAACACTGTTGGATATCAAATTTGCCACCATATGAATCTTGTTCCTGTCCCAGGATTATACTGGCCTCAATATCAATCAGTGACGTCTTCTTCATAACAGTTCTGGGATACAGTTTTCCATTGATCCAGAGCTGAACCACACCCGACTCAGATTCCCAGCTTACACAGGTATGTTTCCAGTCCAAAACCTCTGGGTTTACTTGGAAATTATAAGATTCTTGGTTTACAAACAACTGATACCTGTTTGGTGGCTCTGAGTAGATGAGAAGAGCATTGTCCATCCCCGGCACGGCCAAAGAGAAAAGAGAATGTTCTCGAGTGAAGGCTGTGTAGGATTCCGGGCAAACAGTTACACTCTCTACTCTCTTTGTTATCATAGGCTTTAGAATCAAACGGGCGGTAGCTGTGGGCCTGGGGAAAAAGAGAGACCTTTCCTCCCAAACCTCCGGCCCCAAAAAATCCGGGAAAAAAGAAAAAACAAAAAGAAAAAACATGGCCATGGGGGCCAACTTTTTTTGGAACAAAGTTTGGGCAATAA
Full Trace Sequence: GGGAAAACGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTTTCATAGCACACAGAATGCAAGTTATAATTATTCCCTAGAGATCGGCATTGTAGCTGGGGCTGGACAACCACATCTCCTTTTATCTCATACTGCAATGATCTCCAGTTAATAATGTTGCCATTCATATCTTTTTTTCCAGCCAGAACCTTCTGTATTTCTTCCTGGGTCAGTACATAATCCCACATGTGTACGTTGGTTATCTCGCCCACAAAACACTGTTGGATATCAAATTTGCCACCATATGAATCTTGTTCCTGTCCCAGGATTATACTGGCCTCAATATCAATCAGTGACGTCTTCTTCATAACAGTTCTGGGATACAGTTTTCCATTGATCCAGAGCTGAACCACACCCGACTCAGATTCCCAGCTTACACAGGTATGTTTCCAGTCCAAAACCTCTGGGTTTACTTGGAAATTATAAGATTCTTGGTTTACAAACAACTGATACCTGTTTGGTGGCTCTGAGTAGATGAGAAGAGCATTGTCCATCCCCGGCACGGCCAAAGAGAAAAGAGAATGTTCTCGAGTGAAGGCTGTGTAGGATTCCGGGCAAACAGTTACACTCTCTACTCTCTTTGTTATCATAGGCTTTAGAATCAAACGGGCGGTAGCTGTGGGCCTGGGGAAAAAGAGAGACCTTTCCTCCCAAACCTCCGGCCCCAAAAAATCCGGGAAAAAAGAAAAAACAAAAAGAAAAAACATGGCCATGGGGGCCAACTTTTTTTGGAACAAAGTTTGGGCAATAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTTTCATAGCACACAGAATGCAA