ORFeome > MGC116522 ORF1 – XORFeome v1.0

MGC116522 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5761343
Gene Page ID: 5761341
ORF Xenbase ID: 17257317

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099328
Original XGC clone length: 654

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: F11

Sequences - 5ʹ (forward) EST

Accession: JZ840136
dbEST ID: 79657838
Trimmed Sequence: ATGGGACACCACACTTCTGGGATCTGGGTATGGTTGGCCTTGACACTTTCCATCTCAAGTGCCTATGACATTATTCCAGGTAGACCCATCGACCACACTAAGTCTATCTGCAGTTCATGGGGAAACTTCAATTACAAGACATTTGATGGAGTTATCTATCAGTTTCCTGGTACCTGCAACTATAATTTGGCTACAGACTGTGGAGACTCCTATCGTGAATTTTCTGTCCATATCAAGCGTTCCACTGAGAATGGCAGCCCTGTCATTCACCAGATCCTAATGCAAATCAAGGACGTTACCGTTGAACTGAAGAGAGATGACCAGACGGTGAATGGGGTCACTTTTGAGACCCCTTACTTCAACTATGGAATTCTCATAAATGAGAAGGATGGGTACTTAAAGGTGGACACAAAAATTGGCCTGACCCTCACATTTAACAATGAAGATTCAGTTATGTTAGAGCTGGATGCCAGTTATAAAGGCAAGCTGTGTGGACTCTGCGGGGATTACAATGGCATGCCTGTCAGTAATGAATTCTATATGAATGATATGGCACTCACCCCTCTCCAGTTTGGAAATATGCAAAACATCAACGATCCAACTATTACCTGCTCAAATGTAGATGAGACCCACCAACTGAATGTTTTCCACTTT
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGACACCACACTTCTGGGATCTGGGTATGGTTGGCCTTGACACTTTCCATCTCAAGTGCCTATGACATTATTCCAGGTAGACCCATCGACCACACTAAGTCTATCTGCAGTTCATGGGGAAACTTCAATTACAAGACATTTGATGGAGTTATCTATCAGTTTCCTGGTACCTGCAACTATAATTTGGCTACAGACTGTGGAGACTCCTATCGTGAATTTTCTGTCCATATCAAGCGTTCCACTGAGAATGGCAGCCCTGTCATTCACCAGATCCTAATGCAAATCAAGGACGTTACCGTTGAACTGAAGAGAGATGACCAGACGGTGAATGGGGTCACTTTTGAGACCCCTTACTTCAACTATGGAATTCTCATAAATGAGAAGGATGGGTACTTAAAGGTGGACACAAAAATTGGCCTGACCCTCACATTTAACAATGAAGATTCAGTTATGTTAGAGCTGGATGCCAGTTATAAAGGCAAGCTGTGTGGACTCTGCGGGGATTACAATGGCATGCCTGTCAGTAATGAATTCTATATGAATGATATGGCACTCACCCCTCTCCAGTTTGGAAATATGCAAAACATCAACGATCCAACTATTACCTGCTCAAATGTAGATGAGACCCACCAACTGAATGTTTTCCACTTTGCCACTTTCTTGTACAAAGTTGGCATTATAAGAAAACATTGCTTATCAATTTGTTGCAACCAACAAGGTCACTATTAGTCAAAATTAAAATCCATAATTTGCCATCCCAGCTTAATACCCCCCTAATAGTGAAATACAAAAAAAAAAATAGAAAAAAAAACAGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGACACCACACTTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ840135
dbEST ID: 79657837
Trimmed Sequence: GTTGGAAACATTCAGTTGCTGGGTCTCATCTACATTTGAGCAGGTAATAGTTGGATCGTTGATGTTTTGCATATTTCCAAACTGGAGAGGGGTGAGTGCCATATCATTCATATAGAATTCATTACTGACAGGCATGCCATTGTAATCCCCGCAGAGTCCACACAGCTTGCCTTTATAACTGGCATCCAGCTCTAACATAACTGAATCTTCATTGTTAAATGTGAGGGTCAGGCCAATTTTTGTGTCCACCTTTAAGTACCCATCCTTCTCATTTATGAGAATTCCATAGTTGAAGTAAGGGGTCTCAAAAGTGACCCCATTCACCGTCTGGTCATCTCTCTTCAGTTCAACGGTAACGTCCTTGATTTGCATTAGGATCTGGTGAATGACAGGGCTGCCATTCTCAGTGGAACGCTTGATATGGACAGAAAATTCACGATAGGAGTCTCCACAGTCTGTAGCCAAATTATAGTTGCAGGTACCAGGAAACTGATAGATAACTCCATCCAATGTCTTGTAATTGAAGTTTCCCCATGATCTGCAGATAGACTTATTGTGGTCGATGGGTCTACCTGGAATAATGTCATAGGCACTTGAGATGGAAAGTGTCAGGGCCAACCATACCCAGATCCCAAAAATGTGGTGTCCCATGGTGGCAACTTTTTTTGTCAAAATTTGGCTTTAAAAAAAAACATTTGCTCAACAATTTTTTTGCAACGAAAAAGGGTCACTAAACAAAAAAAAAAAAAAATCAATAATTTGGGGGGC
Full Trace Sequence: GCGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGGAAACATTCAGTTGCTGGGTCTCATCTACATTTGAGCAGGTAATAGTTGGATCGTTGATGTTTTGCATATTTCCAAACTGGAGAGGGGTGAGTGCCATATCATTCATATAGAATTCATTACTGACAGGCATGCCATTGTAATCCCCGCAGAGTCCACACAGCTTGCCTTTATAACTGGCATCCAGCTCTAACATAACTGAATCTTCATTGTTAAATGTGAGGGTCAGGCCAATTTTTGTGTCCACCTTTAAGTACCCATCCTTCTCATTTATGAGAATTCCATAGTTGAAGTAAGGGGTCTCAAAAGTGACCCCATTCACCGTCTGGTCATCTCTCTTCAGTTCAACGGTAACGTCCTTGATTTGCATTAGGATCTGGTGAATGACAGGGCTGCCATTCTCAGTGGAACGCTTGATATGGACAGAAAATTCACGATAGGAGTCTCCACAGTCTGTAGCCAAATTATAGTTGCAGGTACCAGGAAACTGATAGATAACTCCATCCAATGTCTTGTAATTGAAGTTTCCCCATGATCTGCAGATAGACTTATTGTGGTCGATGGGTCTACCTGGAATAATGTCATAGGCACTTGAGATGGAAAGTGTCAGGGCCAACCATACCCAGATCCCAAAAATGTGGTGTCCCATGGTGGCAACTTTTTTTGTCAAAATTTGGCTTTAAAAAAAAACATTTGCTCAACAATTTTTTTGCAACGAAAAAGGGTCACTAAACAAAAAAAAAAAAAAATCAATAATTTGGGGGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGGAAACATTCAGTTGCTGG