ORFeome > MGC116527 ORF1 – XORFeome v1.0

MGC116527 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6255562
Gene Page ID:
ORF Xenbase ID: 17257323

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099332
Original XGC clone length: 984

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: B08

Sequences - 5สน (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GCTCGGGGGCCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCNCNNATTGATGAACAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTCCTCTACTACAAGCTCCACCTACCAGTTCTATTGATAACACAGCTCCATCCATCATTAGCTCCATTCTACATATCATTTGGATGACTGTTCTGCTATTTTGCCTATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCGCCCGAGCTATAGACTGGATGTCGTTTCATATTACATGGTCATAGACTGTTTCCTGGCAGCTCTGGCCCGTGACTCGAAAAATCAAAAGTAACAAAACAGAAGAGAGAGAGAAATCATGGCGCCACGTCAAGACCAGGCGCGACAGAAAAGCCTCCCCTTCGTTGCTACCGAGGGGGGCGGGGTGACGGTAGGAGAGCACAGCAATAAGGGGAGTTAGCCTGGGAGAATTAAGCTTGTTGGGTGCTAAAGCTGTGATGGCATAAGAGTATGCACTCACACCACTGGGTTGAATAAGTTGAATCGAACGCGGCGGGTGGTAAAGTGGAATTGTCGGTTTTACTTGGCATGTAGAGACTTTTTCTTTGGGTGAATACTGAATGCTGGAGGTTTCTAAGCAGACAAATGCATTTAAAATGGTGGGTGCTTTGTAAGAATTAATAAAGAAAAAGATAAAATGAATATATTAAAGCGAAAACTTCAATAAAACATATAATGATATGAAAAGGGATATACAAGAACAGACTAATATAAATAGCTTAATAAAGACGCAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTCCTCTACTACAAGCTC

Sequences - 3สน (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGAAATATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTNACTNATNNTNACCTNTTCNTTNCNNCNNNTTNNTNNNCNNTNCTTTCTTATNNTNCCNNCTTTNTNCNNAANNNTTNNCNNTANNCNNAATANCAAAACANTCATCCAAATNATATNTANAATNNANCTAATNATNNATNNANCTNTNTTATCAATANAACTTNTANNATNNANCTTNTATTANANNAATCATTTTACCAACTTTTTTTTTCAAANATTTCATTATAAAAAAACATTCCTCATCAATTTATTCCAACTAACAACTCACTATCATTCAAAATATAATCATTATTATACATCCAACCTATATACTCACTACTCTATTTAAAAAAAAATACATAACAAATACTTCTAACTCTTTATAACAACACACCATACAAAAAAAATACACCAAATATAACCCCACAACTCCCTTCCTAACAACTTTTCCCTTATAATCACACAAACCCAAACCAATCAACCCTCAACCCCATTTAAACTTAAACCTCTTCTACTCAAAATCCAACACTCCTAATCACATACCCCACAAAATCACTTNATCCTAAAACTTAACCNAAAACACCANNTTTAATCTAACTTTTTTACTTTTTACTTACTTTTCTACAACATCCTTATCACCATACACTCCTAACACTCTCCCATTTTAATTATTATAAACACTACAAATCTACCCATACAATAATCAACCTCAAACACCCACAAAAAAATTAACACAACACAACACCCCTCCCTCCCAATCCTAAATAAATATTTATATTTTATNAATNAATCTTATCTCACCAAAACCACATTCACCCACACAAATACTTAAATTAATAATTCCCCACTTCCTCCCCTAAACCATCAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGGCAAAATAGCAGAACAGTCA