ORFeome > MGC131077 ORF1 – XORFeome v1.0

MGC131077 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6255276
Gene Page ID:
ORF Xenbase ID: 17257509

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC106416
Original XGC clone length: 450

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ838012
dbEST ID: 79655714
Trimmed Sequence: ATGTATTCCCGTATCATCGCTGTCATTGGCGGTTTCCTGGTCTTGGCCAGCGGCGCGGGAGAGATTTACAGGCAGAAGCCGCGCAGTCGCTCGTTGCAGTCCACGGGTCAGGTCTTCCTTGGTATTTACCTCATCTGTGTAGCTTACACTCTGCAGCACAGTAAAGACGACCGACTGGCGTATCTAGACTTCATCCCGGGGGGAGAGCCTGCGCTTCAGATCCTCTTTGTCCTGTACGGGGTCCTGGCTCTGTCTTTCCTCTCTGGATATTACGTCCGTTCCACATCTCAGGTCCTGGCCGTGCTGCTGCCCTTTTCTCTGCTCCTCATCGACGGCAACCTCGGCTACTGGCACAGCTCCCGCAAGGTGGAGTTCTGGAATCAGATGCGCTTGATTGGTCAGAACGTGGGCATCTTCGGGGCGGTCGTCATATTGGCCACAGATGGCTT
Full Trace Sequence: GCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTATTCCCGTATCATCGCTGTCATTGGCGGTTTCCTGGTCTTGGCCAGCGGCGCGGGAGAGATTTACAGGCAGAAGCCGCGCAGTCGCTCGTTGCAGTCCACGGGTCAGGTCTTCCTTGGTATTTACCTCATCTGTGTAGCTTACACTCTGCAGCACAGTAAAGACGACCGACTGGCGTATCTAGACTTCATCCCGGGGGGAGAGCCTGCGCTTCAGATCCTCTTTGTCCTGTACGGGGTCCTGGCTCTGTCTTTCCTCTCTGGATATTACGTCCGTTCCACATCTCAGGTCCTGGCCGTGCTGCTGCCCTTTTCTCTGCTCCTCATCGACGGCAACCTCGGCTACTGGCACAGCTCCCGCAAGGTGGAGTTCTGGAATCAGATGCGCTTGATTGGTCAGAACGTGGGCATCTTCGGGGCGGTCGTCATATTGGCCACAGATGGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAATATCATTATTTGCCATCCAACTTATATCCCCTATAGTGAGTCGTAATAACTGGTCAAAAAAAAAAAAAAGGAAAAACTAAAACTATAACAAAGGATCCCCTGAGACTAAAAAGAAAAAAAGGGCCGGCGTCTACGGGCCCCATGGTGTGCCGGGGGAGTCTCGCGGGGGGAACGGGTGAAGGGGAAACACAGGGGAAAAAAAAAAAAAAAGATATAAACTAAAGAAGAAAGAGTATGGCCCCCCCCCCAGCGGTGCCAAAAACTGAACACGAAAACGCGGGGGGGTAAGGCGCCGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTATTCCCGTATCATCGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838011
dbEST ID: 79655713
Trimmed Sequence: GCCATCTGTGGCCAATATGACGACCGCCCCGAAGATGCCCACGTTCTGACCAATCAAGCGCATCTGATTCCAGAACTCCACCTTGCGGGAGCTGTGCCAGTAGCCGAGGTTGCCGTCGATGAGGAGCAGAGAAAAGGGCAGCAGCACGGCCAGGACCTGAGATGTGGAACGGACGTAATATCCAGAGAGGAAAGACAGAGCCAGGACCCCGTACAGGACAAAGAGGATCTGAAGCGCAGGCTCTCCCCCCGGGATGAAGTCTAGATACGCCAGTCGGTCGTCTTTACTGTGCTGCAGAGTGTAAGCTACACAGATGAGGTAAATACCAAGGAAGACCTGACCCGTGGACTGCAACGAGCGACTGCGCGGCTTCTGCCTGTAAATCTCTCCCGCGCCGCTGGCCAAGACCAGGAAACCGCCAATGACAGCGATGATACGGGAATACATGG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCCATCTGTGGCCAATATGACGACCGCCCCGAAGATGCCCACGTTCTGACCAATCAAGCGCATCTGATTCCAGAACTCCACCTTGCGGGAGCTGTGCCAGTAGCCGAGGTTGCCGTCGATGAGGAGCAGAGAAAAGGGCAGCAGCACGGCCAGGACCTGAGATGTGGAACGGACGTAATATCCAGAGAGGAAAGACAGAGCCAGGACCCCGTACAGGACAAAGAGGATCTGAAGCGCAGGCTCTCCCCCCGGGATGAAGTCTAGATACGCCAGTCGGTCGTCTTTACTGTGCTGCAGAGTGTAAGCTACACAGATGAGGTAAATACCAAGGAAGACCTGACCCGTGGACTGCAACGAGCGACTGCGCGGCTTCTGCCTGTAAATCTCTCCCGCGCCGCTGGCCAAGACCAGGAAACCGCCAATGACAGCGATGATACGGGAATACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTTGGGGCCCGAAAAAAAAACAGAAAATCAATATACACTTCAATGGACTGCGCGGAAACCAACAAGAGAAAAGGGCCTCTCCATAACTTGCGCCCTCGGTTTGTCTGTGTGTGTTCTCTGGGGAAACAAGGTAAAAGGAGGACAACCCCGGGGGGAGAAGCTTTGTTTGGTTTTGAGGACTGGGATGGGGGGGGGGGTGGGGGGGCCCCANCGACCAAGGGTGGGCACAAAACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCATCTGTGGCCAATATGA