ORFeome > MGC131088 ORF1 – XORFeome v1.0

MGC131088 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6254516
Gene Page ID:
ORF Xenbase ID: 17257515

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110763
Original XGC clone length: 1254

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: A04

Sequences - 5ʹ (forward) EST

Accession: JZ837973
dbEST ID: 79655675
Trimmed Sequence: ATGGCAAAAGCCAAAGTGACGAAGGACCAATCGCCTGCGAGCGGCTGTTCTGTAAAAAACGCAAACACTCAGAAACAGACGAAGAAGCAGAAAAAGAAGAAATTCTGGCAAAACCACCCTAAAATCACTGCCAAGACAAACGAAGATGTAAAGGTTTCTCCTCTGCTGCCCCCCAAAAAGCCCCAAGAATTCTCATCCAACTGGAAAGCGCTACAGGAGCTGTTGAAGCAGAAGGCAAAACCAGCAGTACCTGCACTGTCTACTGAATTACTTAAGAAAGACCAAAAAGTGTCAGAGAAGAAAAATGAGGAGTCTACCCCTCCTAAAAGTGCCCCCAAAATAAATGGTGGCATAAAAAGTGTATCTGCAACAGCAAAGGAAACCAAGGCACCTTCACAAGCACCGTCTACAAAAGCCAGGGAGAAGACAGAGGAGGTGAAGAAAGGAAAGAAACGGAAGATCAAAGCAGAGGGCACAGCTGAAGAGCACCAAGCAAAGAAGCCTCAAGTGGAGACCCAGCCAGAACCACCAAAAGTGGATATCTGGTTTGATGATGTAGATCCGGATGACATTGAGGCGGCCCTGGGGCCAGAGGCTGGACGCATCGCTCGTGAGATGCAAGGGGGCACAGAAACCAAATCTGCGACTGGTGAAAAGGTTTCTTGTGAAAAAAAAAGGCATTTGAAGGGGCTAACTCCGGGCCGTTCCATGGAATTGCCAAAATGGTTGGAAGGGGAAAGTGAATGGAAAAGGAAAAAAAACAAAACCCCCGTTCTCCCCCCTGTTCCATCTCTGTTTTGGGCAAGGGGGGGGTGGG
Full Trace Sequence: TCGAGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAAAAGCCAAAGTGACGAAGGACCAATCGCCTGCGAGCGGCTGTTCTGTAAAAAACGCAAACACTCAGAAACAGACGAAGAAGCAGAAAAAGAAGAAATTCTGGCAAAACCACCCTAAAATCACTGCCAAGACAAACGAAGATGTAAAGGTTTCTCCTCTGCTGCCCCCCAAAAAGCCCCAAGAATTCTCATCCAACTGGAAAGCGCTACAGGAGCTGTTGAAGCAGAAGGCAAAACCAGCAGTACCTGCACTGTCTACTGAATTACTTAAGAAAGACCAAAAAGTGTCAGAGAAGAAAAATGAGGAGTCTACCCCTCCTAAAAGTGCCCCCAAAATAAATGGTGGCATAAAAAGTGTATCTGCAACAGCAAAGGAAACCAAGGCACCTTCACAAGCACCGTCTACAAAAGCCAGGGAGAAGACAGAGGAGGTGAAGAAAGGAAAGAAACGGAAGATCAAAGCAGAGGGCACAGCTGAAGAGCACCAAGCAAAGAAGCCTCAAGTGGAGACCCAGCCAGAACCACCAAAAGTGGATATCTGGTTTGATGATGTAGATCCGGATGACATTGAGGCGGCCCTGGGGCCAGAGGCTGGACGCATCGCTCGTGAGATGCAAGGGGGCACAGAAACCAAATCTGCGACTGGTGAAAAGGTTTCTTGTGAAAAAAAAAGGCATTTGAAGGGGCTAACTCCGGGCCGTTCCATGGAATTGCCAAAATGGTTGGAAGGGGAAAGTGAATGGAAAAGGAAAAAAAACAAAACCCCCGTTCTCCCCCCTGTTCCATCTCTGTTTTGGGCAAGGGGGGGGTGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAAAAGCCAAAGTGACGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837972
dbEST ID: 79655674
Trimmed Sequence: TGTTTTTTGTTTTTGGGACCCTTTCTCTTTCCTGCCAACAGGCTTAAAGCCGGTATATTTGGCTTTAATGGCAGCTTCCCAGCATTTCTTCTCCATGGTGTATAAGCGCATGGCAGCCTGGGCATCTTGAACCGAGCAGTGCTCCCCGGTCTGCACCTTCACATTCAGGATCTTCTCACACAGAAGTTTCAGGGACGGGCGCCCATTCTTTACTTTCTGCTTAAAGGGTTTGTATTTCTGGGTGTCCCTGATGGCCTTTTTGGGGTGATCTAAGAAAAGAATCTTCAGATCATTATGTATAGCGTGTCCGACTAAGGTGCGTCCTCTGAGAATTTCTGAAACCTCCTTCTGAACAACCTTAAAAGATTCCCCGTTCTTAATGTCCTTGGGTCTGATGCCGCTCACCGCTGTCCTATAGTCAGTCACTTGTTCCGTTGGCTTGACAAACTTGTCATACACACACTTGCCAAACACATTGACCATGGAGACACGGGCTAAGATACTCTCCTCTCCATCCATTCCCACTCCCACCATCTCGCAGTCCATGGCAACGGCCCCGAGTAAACCCTTCCAAGGCCTTCTCTTTCACAAAAACCCTATCCACACTCCCACATTTTATCTCTTTGAAGCCCTTTCTTCCCCCGAGGCGATGGGCCGACCCTCGGGCCCCAGGGGCGCCCCCAGGGGCCAGCGGAAATCAAAAACTCAAAAACCAAAAAACCCAAATTAGGGGGGGTTGCGGGCGGGGGGGGCGCGGGGTGGGAGGGGCTTCTTTTCCCTGGG
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATANGGGGATAGTCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTTTTTTGTTTTTGGGACCCTTTCTCTTTCCTGCCAACAGGCTTAAAGCCGGTATATTTGGCTTTAATGGCAGCTTCCCAGCATTTCTTCTCCATGGTGTATAAGCGCATGGCAGCCTGGGCATCTTGAACCGAGCAGTGCTCCCCGGTCTGCACCTTCACATTCAGGATCTTCTCACACAGAAGTTTCAGGGACGGGCGCCCATTCTTTACTTTCTGCTTAAAGGGTTTGTATTTCTGGGTGTCCCTGATGGCCTTTTTGGGGTGATCTAAGAAAAGAATCTTCAGATCATTATGTATAGCGTGTCCGACTAAGGTGCGTCCTCTGAGAATTTCTGAAACCTCCTTCTGAACAACCTTAAAAGATTCCCCGTTCTTAATGTCCTTGGGTCTGATGCCGCTCACCGCTGTCCTATAGTCAGTCACTTGTTCCGTTGGCTTGACAAACTTGTCATACACACACTTGCCAAACACATTGACCATGGAGACACGGGCTAAGATACTCTCCTCTCCATCCATTCCCACTCCCACCATCTCGCAGTCCATGGCAACGGCCCCGAGTAAACCCTTCCAAGGCCTTCTCTTTCACAAAAACCCTATCCACACTCCCACATTTTATCTCTTTGAAGCCCTTTCTTCCCCCGAGGCGATGGGCCGACCCTCGGGCCCCAGGGGCGCCCCCAGGGGCCAGCGGAAATCAAAAACTCAAAAACCAAAAAACCCAAATTAGGGGGGGTTGCGGGCGGGGGGGGCGCGGGGTGGGAGGGGCTTCTTTTCCCTGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTTTTTTGTTTTTGGGACCCTTT