ORFeome > MGC131113 ORF1 – XORFeome v1.0

MGC131113 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6254515
Gene Page ID:
ORF Xenbase ID: 17257527

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110769
Original XGC clone length: 2007

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: F10

Sequences - 5ʹ (forward) EST

Accession: JZ837961
dbEST ID: 79655663
Trimmed Sequence: ATGGAGTCCCCTCCGGTGGTGGTCGGGCAGCGGGTGCGGGCCGTGCTGGATGTGGCCTTGCGGGTTCCCTCTCTTTTTATCACGGACGCCATCCTGAACTTGCCTCACGATGCCTCTGCCGGCTTCCTGTCACTGCTGCTGCAGCTCGCGCTCAGACTTCTGGGTGTTGTGGCATCCATGGTTGTGCTGGTGTTGTCTCGCAGAGCACTTTTCAAGTTCTACATGATCACCACAGCCCTGGGTCTGGCTGCAACTTCAGTGTTGGTCAATTACTATTCCACCTTGCACTTGAACTCTTACCGTGCCTCCTCATCGGAGGCTTTTGGGCTTGAATTTCTTCCTTCCAACGGACCTTCGCTATGGATGACGCTTATTATATTACAACTTATTTTTGGCATTGGCTTCATCACGTTACTCCAAGTCCAGTCCTACTCCCAGCTAATAATACTCAATCTGCTAATCCCCACCGTCGGCTTGATAATAGAACTCCCGCTTGGTGTGCAACAAATTTTGGTCTTCGTCTCCGCCTTTGTTCTTGTACTCTACACTGCTAGTTGCTTGGCTTTCCGATTCAAGTGGTTCTACTACTCGACAAAATATACCGTGCTCCTCCTCAAACACATGTACCAAGTGTATGGAATGCAGCTCATGGTGGAAGATGCTTGGAAAAAGATTCCTTCCCAAACTTACTGCCGGTTTTTCTGGCTAACCCCCTTAACAACCCCAGCCCGTGTTTTTTTTCTATTTGGTCAAAACTTCGAAAGTTTAAACCCGGGGGAAGGTTTCTTAACGTTTATACCTTGAAAAATGCATTTTGGGAAAC
Full Trace Sequence: CGGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGTCCCCTCCGGTGGTGGTCGGGCAGCGGGTGCGGGCCGTGCTGGATGTGGCCTTGCGGGTTCCCTCTCTTTTTATCACGGACGCCATCCTGAACTTGCCTCACGATGCCTCTGCCGGCTTCCTGTCACTGCTGCTGCAGCTCGCGCTCAGACTTCTGGGTGTTGTGGCATCCATGGTTGTGCTGGTGTTGTCTCGCAGAGCACTTTTCAAGTTCTACATGATCACCACAGCCCTGGGTCTGGCTGCAACTTCAGTGTTGGTCAATTACTATTCCACCTTGCACTTGAACTCTTACCGTGCCTCCTCATCGGAGGCTTTTGGGCTTGAATTTCTTCCTTCCAACGGACCTTCGCTATGGATGACGCTTATTATATTACAACTTATTTTTGGCATTGGCTTCATCACGTTACTCCAAGTCCAGTCCTACTCCCAGCTAATAATACTCAATCTGCTAATCCCCACCGTCGGCTTGATAATAGAACTCCCGCTTGGTGTGCAACAAATTTTGGTCTTCGTCTCCGCCTTTGTTCTTGTACTCTACACTGCTAGTTGCTTGGCTTTCCGATTCAAGTGGTTCTACTACTCGACAAAATATACCGTGCTCCTCCTCAAACACATGTACCAAGTGTATGGAATGCAGCTCATGGTGGAAGATGCTTGGAAAAAGATTCCTTCCCAAACTTACTGCCGGTTTTTCTGGCTAACCCCCTTAACAACCCCAGCCCGTGTTTTTTTTCTATTTGGTCAAAACTTCGAAAGTTTAAACCCGGGGGAAGGTTTCTTAACGTTTATACCTTGAAAAATGCATTTTGGGAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTCCCCTCCGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837960
dbEST ID: 79655662
Trimmed Sequence: TTCCCCAAGAGAGTCTGTATCGTCGCTGACGTGTTCCTCCGAAGTGGAGTTGTGTGGTTCCATCGTCCATTCCTCCTCGTCGCACTCCACACTGTCATCTTCACTGAGGTTTTGCTCATCGAGTTCCTGATCAGCCTCCCGATCAGCGTCGGGTGGAGCGGGTTCAGGTGGAGCGGGTTCCTCCTGGGGCACAACAAAAACGTTATTGTTTGATACAGAGGCATTCTCTTTTGAATCATCATCGATATAGACTTTCTGATGGCACATAGGACAAGTGTCTTGTATGTACAACCACTTGCGAAGACAAAGGGCATGGAAATAATGGTGGCAGGGAGTAATACGGGCGGAGGTGTGGAACTCTTGGTAGCAGATTGCACACACATCGTCAATCTCTCGCGACTCCGAACCCTTGACTTCTGGAAGAGAGTTGATCTTTTTCACGGCTTTCCTCCGGTTCATGAAGGTCTTCCACCCGTTCTTGGCTTGCAGGTAGATGTTGAAGTAAGCGTGCAGACACATCATGCACGCTCGGATCTTGCTGCCGGATTCAAACATCATCGTGTANGCCCCGTTTCCGACATAATTACTCCAAAGACGAACTCGACAATACTACCAGTTGAGCGCACGTAGTAAACATATTCGTCCAGCTTTTTCCACAGCACGTTATAGTAGCCGTCGATCATAAACAGTTGTGTAGAACGGCAGAGGAACCATGACTTTTTAAACGAAATTTCACCGCAAAAAGGGCTTGACGGGCAAACCAACCCTTT
Full Trace Sequence: AAGACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCCCCAAGAGAGTCTGTATCGTCGCTGACGTGTTCCTCCGAAGTGGAGTTGTGTGGTTCCATCGTCCATTCCTCCTCGTCGCACTCCACACTGTCATCTTCACTGAGGTTTTGCTCATCGAGTTCCTGATCAGCCTCCCGATCAGCGTCGGGTGGAGCGGGTTCAGGTGGAGCGGGTTCCTCCTGGGGCACAACAAAAACGTTATTGTTTGATACAGAGGCATTCTCTTTTGAATCATCATCGATATAGACTTTCTGATGGCACATAGGACAAGTGTCTTGTATGTACAACCACTTGCGAAGACAAAGGGCATGGAAATAATGGTGGCAGGGAGTAATACGGGCGGAGGTGTGGAACTCTTGGTAGCAGATTGCACACACATCGTCAATCTCTCGCGACTCCGAACCCTTGACTTCTGGAAGAGAGTTGATCTTTTTCACGGCTTTCCTCCGGTTCATGAAGGTCTTCCACCCGTTCTTGGCTTGCAGGTAGATGTTGAAGTAAGCGTGCAGACACATCATGCACGCTCGGATCTTGCTGCCGGATTCAAACATCATCGTGTANGCCCCGTTTCCGACATAATTACTCCAAAGACGAACTCGACAATACTACCAGTTGAGCGCACGTAGTAAACATATTCGTCCAGCTTTTTCCACAGCACGTTATAGTAGCCGTCGATCATAAACAGTTGTGTAGAACGGCAGAGGAACCATGACTTTTTAAACGAAATTTCACCGCAAAAAGGGCTTGACGGGCAAACCAACCCTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCCCAAGAGAGTCTGT