ORFeome > MGC131117 ORF1 – XORFeome v1.0

MGC131117 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6254718
Gene Page ID:
ORF Xenbase ID: 17257533

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108599
Original XGC clone length: 1170

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: E10

Sequences - 5ʹ (forward) EST

Accession: JZ837938
dbEST ID: 79655640
Trimmed Sequence: ATGCCTGCCGAAAACCTGGAGGAGCAGGGCCTGGAGAAGAACCCCAACCTGGAGCTGGCCCAAACCAAATTCCTGCTCACTTTGGCGGAGCACAAACAGGATGCTATCCTGAAAGGGAAACTTTTGGAAGCAATTCGCACGGATAATATGGCTCCGTGGTACGAGCATATATGCGCAGAGCTCGGCTGGACGTTGGATAAGGACCTGTTGGCCCGCATGAAGGAGAACAATCGCGTGGAGCTGGAACAGCTGGACGCGGCCATCGAGGACGCGGAAAAGAATCTTGGTGAGATGGAGGTTCGCGAGGCGAATCTTAAGAAGTCAGAATATCTGTGCCGCATCGGTGACAAAGTAGCGGCGGAGTCGGCTTTCCGCAAAACCTACGAAAAGACTGTGTCATTGGGACACCGCCTTGACATCGTGTTCCACTTAATCCGCCTGGGCCTCTTCTACTTGGACCACGATCTCATCACGCGCAACATCGACAAGGCAAAGTACCTAATCGAGGAAGGCGGCGACTGGGACCGTCGCAACCGGCTTAAGGTTTACCAGGGTGTCTACTCAATTGCCGTGCGTGACTTCAAGGCGGCTGCCACCTTTTTCCTGGATACCGTGAGCACCTTTACGTCGTACGAGCTGATGGACTACCCCACCTTCGTGAGATACACCGTCAATGTTTCCCTTATCCCCTTTACCACCCATGAATTTGCGCGACAAAATAATCCAAGGGATCTGAAATACAGGAAATTTCCTTCCTGTTCCGGCCCCAACGTTTAAACAATTTCCCCTTTTCCCCCTCCTAACACATTGTTAT
Full Trace Sequence: CCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTGCCGAAAACCTGGAGGAGCAGGGCCTGGAGAAGAACCCCAACCTGGAGCTGGCCCAAACCAAATTCCTGCTCACTTTGGCGGAGCACAAACAGGATGCTATCCTGAAAGGGAAACTTTTGGAAGCAATTCGCACGGATAATATGGCTCCGTGGTACGAGCATATATGCGCAGAGCTCGGCTGGACGTTGGATAAGGACCTGTTGGCCCGCATGAAGGAGAACAATCGCGTGGAGCTGGAACAGCTGGACGCGGCCATCGAGGACGCGGAAAAGAATCTTGGTGAGATGGAGGTTCGCGAGGCGAATCTTAAGAAGTCAGAATATCTGTGCCGCATCGGTGACAAAGTAGCGGCGGAGTCGGCTTTCCGCAAAACCTACGAAAAGACTGTGTCATTGGGACACCGCCTTGACATCGTGTTCCACTTAATCCGCCTGGGCCTCTTCTACTTGGACCACGATCTCATCACGCGCAACATCGACAAGGCAAAGTACCTAATCGAGGAAGGCGGCGACTGGGACCGTCGCAACCGGCTTAAGGTTTACCAGGGTGTCTACTCAATTGCCGTGCGTGACTTCAAGGCGGCTGCCACCTTTTTCCTGGATACCGTGAGCACCTTTACGTCGTACGAGCTGATGGACTACCCCACCTTCGTGAGATACACCGTCAATGTTTCCCTTATCCCCTTTACCACCCATGAATTTGCGCGACAAAATAATCCAAGGGATCTGAAATACAGGAAATTTCCTTCCTGTTCCGGCCCCAACGTTTAAACAATTTCCCCTTTTCCCCCTCCTAACACATTGTTAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTGCCGAAAACCTGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837937
dbEST ID: 79655639
Trimmed Sequence: GATGTTTATCACGCGGCTCAGTTTCTGGATGCGGTTGAGCAGCAGGTCTCCCTGCTTGATGGTTGCTTGGTACTGCCAGTTTTTATTGTCTGGCCGGTTCGTCTCAACGATGCCGCCCACTCGGTCAACCTTGGCATGTAACCGGCCAGCGGCGATGAAGCGAGCCAGCTCCTGGTCGATGTAGTCGACAGTAACGCCAAAAGCTTCCGCCATATACTGAAGAGTGAGGGAGCGGTAGGACTCAAGCAGCTGGGTGTAGCCTAGAATGCGCATCTCGCGCACATAGTAGCGGTAGTGGGGATGGATTAGATAGTCCGCGCGCAGCTGCTTTTCTACGCCGGCTAGATGCACGTAGAAGTTCTCGTACTGACAGTTGTAGAGCGAGAAGAGGAACTGCTTAACGTCGGGCAGACCATGAAGAACTTCCTGTATTTCAGATCCCTTGATTACTTTGTCGCGCAACTCATTGCGTGGTAAGGCGATCATGGACACATAGACGGTGTATCTCACGAAGGTGGTGTAGTCCATCAGCTCGTACGACGTAGAGGTGCTCACGGTATCGGGGGAAAAAGGTGGCAGCCGCCTTTAAGTCACGCACCGGGAATTGAGTAAACCCCCCAGGAAAACCTAAAGCCCGTTGCCAACGGTCCCCGTCGCCGCCTGCCCTCGATAAAGAACTTTTGCCCTGTTCGAATGTTGCCCGTGAAGGAAAATCTGGGGTGCAGGTAAAGAGAAAGGCCAAAGCACAGAATAACGGTGGAACCCCAAA
Full Trace Sequence: AAACAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATGTTTATCACGCGGCTCAGTTTCTGGATGCGGTTGAGCAGCAGGTCTCCCTGCTTGATGGTTGCTTGGTACTGCCAGTTTTTATTGTCTGGCCGGTTCGTCTCAACGATGCCGCCCACTCGGTCAACCTTGGCATGTAACCGGCCAGCGGCGATGAAGCGAGCCAGCTCCTGGTCGATGTAGTCGACAGTAACGCCAAAAGCTTCCGCCATATACTGAAGAGTGAGGGAGCGGTAGGACTCAAGCAGCTGGGTGTAGCCTAGAATGCGCATCTCGCGCACATAGTAGCGGTAGTGGGGATGGATTAGATAGTCCGCGCGCAGCTGCTTTTCTACGCCGGCTAGATGCACGTAGAAGTTCTCGTACTGACAGTTGTAGAGCGAGAAGAGGAACTGCTTAACGTCGGGCAGACCATGAAGAACTTCCTGTATTTCAGATCCCTTGATTACTTTGTCGCGCAACTCATTGCGTGGTAAGGCGATCATGGACACATAGACGGTGTATCTCACGAAGGTGGTGTAGTCCATCAGCTCGTACGACGTAGAGGTGCTCACGGTATCGGGGGAAAAAGGTGGCAGCCGCCTTTAAGTCACGCACCGGGAATTGAGTAAACCCCCCAGGAAAACCTAAAGCCCGTTGCCAACGGTCCCCGTCGCCGCCTGCCCTCGATAAAGAACTTTTGCCCTGTTCGAATGTTGCCCGTGAAGGAAAATCTGGGGTGCAGGTAAAGAGAAAGGCCAAAGCACAGAATAACGGTGGAACCCCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATGTTTATCACGCGGCT