ORFeome > MGC131374 ORF2 – XORFeome v1.0

MGC131374 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5959510
Gene Page ID: 5959486
ORF Xenbase ID: 17257665

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC106616
Original XGC clone length: 1104

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ837727
dbEST ID: 79655429
Trimmed Sequence: ATGGATTCTTCATGCCCCCATGAAGGCGGGCCACTGGAGCAGGGAGACATTGAGGAGTTGTGCGATGGTCGATTGGCATTAACTTGTCCTTGGCATTATTTTGAGTTCTGCTTGGATGACGGCTCTTCCTCTACTGGGTTACAGAACCAGGTATACGAGGTGAAGGTTCATGAAGGGAAGATTTATATTCAAACGCAGAATGCTCTGTCTCTCACCCCTTGGAAGGAAACTTCATGTACGGTTCCTGTTAATTCTGCGCCTGCAGCCATCTCGGAGGATTCAGATGCTGAATCTTCTTTGTCCTATTGGGCCTGCAAAATTCTCAACACTTCGGATCCACAAGAGAAGGTAAAGCTTACACAGCATGTACAAACACTGTGGGAATCCGGAAGAATCCCAGACATCGGTCAAATGGAGCCTCCTGCCCAACCAAAACGTAGAGAGAATCTAATCATTGTACAACCAGGAAGGATTAAGCGGGGAAAGGGTGGAACGCTGACCAGCAAGATTGCTCTGTTGCATTCAATGGCCGACATTGAGCAATGGGCAGTAGACCTGTCATGGGACGTCGTTGCTCGCTTTGCCCATTTCAAACTGCGCACGGGAGAGACACTGGCCAGGGATTTCTTCTCACACTTTGTTAATGTGGCCTGGAGATGAAGGCCAACCACTATAATTCTTGGTGGAGGAGGCGGAGGGTCG
Full Trace Sequence: CGTGGGCCCATAGTAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATTCTTCATGCCCCCATGAAGGCGGGCCACTGGAGCAGGGAGACATTGAGGAGTTGTGCGATGGTCGATTGGCATTAACTTGTCCTTGGCATTATTTTGAGTTCTGCTTGGATGACGGCTCTTCCTCTACTGGGTTACAGAACCAGGTATACGAGGTGAAGGTTCATGAAGGGAAGATTTATATTCAAACGCAGAATGCTCTGTCTCTCACCCCTTGGAAGGAAACTTCATGTACGGTTCCTGTTAATTCTGCGCCTGCAGCCATCTCGGAGGATTCAGATGCTGAATCTTCTTTGTCCTATTGGGCCTGCAAAATTCTCAACACTTCGGATCCACAAGAGAAGGTAAAGCTTACACAGCATGTACAAACACTGTGGGAATCCGGAAGAATCCCAGACATCGGTCAAATGGAGCCTCCTGCCCAACCAAAACGTAGAGAGAATCTAATCATTGTACAACCAGGAAGGATTAAGCGGGGAAAGGGTGGAACGCTGACCAGCAAGATTGCTCTGTTGCATTCAATGGCCGACATTGAGCAATGGGCAGTAGACCTGTCATGGGACGTCGTTGCTCGCTTTGCCCATTTCAAACTGCGCACGGGAGAGACACTGGCCAGGGATTTCTTCTCACACTTTGTTAATGTGGCCTGGAGATGAAGGCCAACCACTATAATTCTTGGTGGAGGAGGCGGAGGGTCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATTCTTCATGCCCC

Sequences - 3ʹ (reverse) EST

Accession: JZ837726
dbEST ID: 79655428
Trimmed Sequence: AGATGGCTTAACCAGAGGCAAGTACCACTCCTCTGACATCCCTGCTGATCTTCTACCCTCTGTATTGAAAGGGGGTTTCAGGTATCCTTTGAAATACAATGGTACCAGCTCATGGAAAGTAGACAAGCAGTCCCGCTGCTCCTTGGCACAGATGTAAGTGAACCATTTCAGTCCCGCAGCCACATGAGTGATCTCATCTGAGTATATTACTTCCATTATTCGGACAGAGCTCTCGTCTCCCTGAGTGGAAAATCGCTGCATTGTCTGAGGGTGAACGTCTAATCCTCTTGCTTCATGGACCATGTGCACAATAGCCAGACGCCCAAGCAGATCATGAGCTGTATCTGCAGCCGACTGCCACAAGCCATTGTGCACAGGTAGAGCTCCAAAGTTTCTGTCCAGTTCTGACAGTCGCTTCTCCAGCAGACTATAGTGCTTGGCTTCATCTCCAGCCACTTTAACAAAGTCTGAGAAGAAATCCCTTGGCAGTGTCTCTCCCGTGCGCAGTTTGAAATGGGCAAAGCGAGCAACGATGTCCCATGACAGGTCTATTGCCCATTGCTCAATGTTGGCCATTGAATGCAACAGAACAATCCTGCTGGTCAGCGTTCCACCCTTTCCCCGCTTAATCCTTCCTGGTTGTACAATGATTAGATTCTCTTTACGTTTTGGTTGGGCAGGAGGCTCCCTTTGACCGATGTCTGGGATTCTTCCGGATTCCCACAATGTTTGTACATGCTGTGTAAGCTTTACCTTCTCTTGTGAATCGAATTGTTAAAAATTTTCCAGCCCAGAGGGACAAAAAAAATCAGCCTCAAAATCCTCCCAAATGGCCGCGGGCGCCAAGTTAAAAGAACCGTAATGAAGTTTCCCTCCAAGGGGTGAAGAAAGGAAGAATCTTCGTTTAAATAAAAGTCTTCCCCTTCCTGACCCTCCCCCCCGAATCCCCGGCTGCGGACGCCCGGGAGAGGAAAAGCGGGCGTTCAACCAAAACTCAAAAAAATCCCAAGGCAAAAGTTAGGGCCGACGCGACCGGCCCCGGGGCCCCCTC
Full Trace Sequence: GGGCGGGGCATCAGCTATGGACCATGTTAATACGACTCACTATNAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGATGGCTTAACCAGAGGCAAGTACCACTCCTCTGACATCCCTGCTGATCTTCTACCCTCTGTATTGAAAGGGGGTTTCAGGTATCCTTTGAAATACAATGGTACCAGCTCATGGAAAGTAGACAAGCAGTCCCGCTGCTCCTTGGCACAGATGTAAGTGAACCATTTCAGTCCCGCAGCCACATGAGTGATCTCATCTGAGTATATTACTTCCATTATTCGGACAGAGCTCTCGTCTCCCTGAGTGGAAAATCGCTGCATTGTCTGAGGGTGAACGTCTAATCCTCTTGCTTCATGGACCATGTGCACAATAGCCAGACGCCCAAGCAGATCATGAGCTGTATCTGCAGCCGACTGCCACAAGCCATTGTGCACAGGTAGAGCTCCAAAGTTTCTGTCCAGTTCTGACAGTCGCTTCTCCAGCAGACTATAGTGCTTGGCTTCATCTCCAGCCACTTTAACAAAGTCTGAGAAGAAATCCCTTGGCAGTGTCTCTCCCGTGCGCAGTTTGAAATGGGCAAAGCGAGCAACGATGTCCCATGACAGGTCTATTGCCCATTGCTCAATGTTGGCCATTGAATGCAACAGAACAATCCTGCTGGTCAGCGTTCCACCCTTTCCCCGCTTAATCCTTCCTGGTTGTACAATGATTAGATTCTCTTTACGTTTTGGTTGGGCAGGAGGCTCCCTTTGACCGATGTCTGGGATTCTTCCGGATTCCCACAATGTTTGTACATGCTGTGTAAGCTTTACCTTCTCTTGTGAATCGAATTGTTAAAAATTTTCCAGCCCAGAGGGACAAAAAAAATCAGCCTCAAAATCCTCCCAAATGGCCGCGGGCGCCAAGTTAAAAGAACCGTAATGAAGTTTCCCTCCAAGGGGTGAAGAAAGGAAGAATCTTCGTTTAAATAAAAGTCTTCCCCTTCCTGACCCTCCCCCCCGAATCCCCGGCTGCGGACGCCCGGGAGAGGAAAAGCGGGCGTTCAACCAAAACTCAAAAAAATCCCAAGGCAAAAGTTAGGGCCGACGCGACCGGCCCCGGGGCCCCCTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGATGGCTTAACCAGAGGCAA