ORFeome > MGC154328 ORF1 – XORFeome v1.0

MGC154328 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5817805
Gene Page ID: 5817485
ORF Xenbase ID: 17257719

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC123140
Original XGC clone length: 699

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: A06

Sequences - 5สน (forward) EST

Accession: JZ838028
dbEST ID: 79655730
Trimmed Sequence: ATGACGTCTCTCTTGTTTTCCCTTTCCATCTCCCTACTCCTCTTCTCGTTGGCAAGGGGATCCCAAGACAAATGCCTACCAGGCAGGACCCCTAATCTGCTTCCCGAGGCAGAAGCAAATTTGCTACAGTGCCAGCAATACTCAGAAAAAGCTTGTTGCACTCAAGAGCAGATAAATGCCCACCCAATCACAAGCTTCCCATGGGGTCTTTGCGGGCCACTCAGTTCCAGCTGTGAGAAGTATGTGAGCCGGGTCCAGTGCATGTATCTCTGCTCCCCGCATATCTCTGCATTCTGGAACCAGGACTCTGACACTGGAATCTATAACCTGCCTTTATGCAGCGGATTCTGCAACCAATGGTTTGAGGCCTGCAAGGAGGATTTAATATGCACGCTGACCAATGAGACCATTCCAAGATGCGCAGATGCATGTGTTCCCTACAAACAGATGTTTAAGTCTGAAGGCGAAGATCTGTGCAATGGCATCTGGGGCGACTCTCTGGTTGCATCGTCAGAGAACTGCGCCTGTGTCAATCCCGTAGGAGAGGGAGACAATCAGGAGACCTTCCATGAAAGAACATCCGGCAGCCACTGTCCCAAAAAGCCACGCAAGTTCATATCCAAGCGCCGTGCGAAGAGGGATACCAGCAGCGATGCGCTGCCCATACCGGACGCCGAAGGAAATGGAAAGGGGAATTTTTCCAAACTTTCTGTTAAAAGTTGGGCAATAAAAAAAAACAATTGCTTAACAATTTGTTTTCCAACAAAAAAGGTTCCTTATCAATTTCAAATAAAAAACCAATTAATTTGGCCCTCCCCCCCCAAA
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACGTCTCTCTTGTTTTCCCTTTCCATCTCCCTACTCCTCTTCTCGTTGGCAAGGGGATCCCAAGACAAATGCCTACCAGGCAGGACCCCTAATCTGCTTCCCGAGGCAGAAGCAAATTTGCTACAGTGCCAGCAATACTCAGAAAAAGCTTGTTGCACTCAAGAGCAGATAAATGCCCACCCAATCACAAGCTTCCCATGGGGTCTTTGCGGGCCACTCAGTTCCAGCTGTGAGAAGTATGTGAGCCGGGTCCAGTGCATGTATCTCTGCTCCCCGCATATCTCTGCATTCTGGAACCAGGACTCTGACACTGGAATCTATAACCTGCCTTTATGCAGCGGATTCTGCAACCAATGGTTTGAGGCCTGCAAGGAGGATTTAATATGCACGCTGACCAATGAGACCATTCCAAGATGCGCAGATGCATGTGTTCCCTACAAACAGATGTTTAAGTCTGAAGGCGAAGATCTGTGCAATGGCATCTGGGGCGACTCTCTGGTTGCATCGTCAGAGAACTGCGCCTGTGTCAATCCCGTAGGAGAGGGAGACAATCAGGAGACCTTCCATGAAAGAACATCCGGCAGCCACTGTCCCAAAAAGCCACGCAAGTTCATATCCAAGCGCCGTGCGAAGAGGGATACCAGCAGCGATGCGCTGCCCATACCGGACGCCGAAGGAAATGGAAAGGGGAATTTTTCCAAACTTTCTGTTAAAAGTTGGGCAATAAAAAAAAACAATTGCTTAACAATTTGTTTTCCAACAAAAAAGGTTCCTTATCAATTTCAAATAAAAAACCAATTAATTTGGCCCTCCCCCCCCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACGTCTCTCTTGTTTTCCCT

Sequences - 3สน (reverse) EST

Accession: JZ838027
dbEST ID: 79655729
Trimmed Sequence: AAATCCACTTCCACTTCCCTCCGCGTCCTGTATGGGCAGCGCATCGCTGCTGGTATCCCTCCTCGCACGGCGCTTGGATATGAACTTGCGTGGCTTTTTGGGACAGTGGCTGCCGGATGTTCTTTCATGGAAGGTCTCCTGATTGTCTCCCTCTCCTACGGGATTGACACAGGCGCAGTTCTCTGACGATGCAACCAGAGAGTCGCCCCAGATGCCATTGCACAGATCTTCGCCTTCAGACTTAAACATCTGTTTGTAGGGAACACATGCATCTGCGCATCTTGGAATGGTCTCATTGGTCAGCGTGCATATTAAATCCTCCTTGCAGGCCTCAAACCATTGGTTGCAGAATCCGCTGCATAAAGGCAGGTTATAGATTCCAGTGTCAGAGTCCTGGTTCCAGAATGCAGAGATATGCGGGGAGCAGAGATACATGCACTGGACCCGGCTCACATACTTCTCACAGCTGGAACTGAGTGGCCCGCAAAGACCCCATGGGAAACTTGTGATTGGGTGGGCATTTATCTGCTCTTGAATGGAACAAGCTTTTTCTGAATATTGCTGGCACTGTAGCCAATTTGTTTCTGCCTCGGGGAAACAGATAAGGGATCCTGCCGGGTAGGCGTGTGGCCTGGGAATCCCTGTGCCCAACGGAGAGAAAAATTGAAGGAAAGGGAAAGGAAAAAACAAAAAAAAAAAGCAAGGTTCGCAGCGGTTGTTTTTTGACAAATTTGGTCGTTTGGTTNNNNNNGCCNATAAAAAACAAAA
Full Trace Sequence: GAACTGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAATCCACTTCCACTTCCCTCCGCGTCCTGTATGGGCAGCGCATCGCTGCTGGTATCCCTCCTCGCACGGCGCTTGGATATGAACTTGCGTGGCTTTTTGGGACAGTGGCTGCCGGATGTTCTTTCATGGAAGGTCTCCTGATTGTCTCCCTCTCCTACGGGATTGACACAGGCGCAGTTCTCTGACGATGCAACCAGAGAGTCGCCCCAGATGCCATTGCACAGATCTTCGCCTTCAGACTTAAACATCTGTTTGTAGGGAACACATGCATCTGCGCATCTTGGAATGGTCTCATTGGTCAGCGTGCATATTAAATCCTCCTTGCAGGCCTCAAACCATTGGTTGCAGAATCCGCTGCATAAAGGCAGGTTATAGATTCCAGTGTCAGAGTCCTGGTTCCAGAATGCAGAGATATGCGGGGAGCAGAGATACATGCACTGGACCCGGCTCACATACTTCTCACAGCTGGAACTGAGTGGCCCGCAAAGACCCCATGGGAAACTTGTGATTGGGTGGGCATTTATCTGCTCTTGAATGGAACAAGCTTTTTCTGAATATTGCTGGCACTGTAGCCAATTTGTTTCTGCCTCGGGGAAACAGATAAGGGATCCTGCCGGGTAGGCGTGTGGCCTGGGAATCCCTGTGCCCAACGGAGAGAAAAATTGAAGGAAAGGGAAAGGAAAAAACAAAAAAAAAAAGCAAGGTTCGCAGCGGTTGTTTTTTGACAAATTTGGTCGTTTGGTTNNNNNNGCCNATAAAAAACAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAATCCACTTCCACTTCCC