ORFeome > MGC154345 ORF1 – XORFeome v1.0

MGC154345 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5814095
Gene Page ID: 5814060
ORF Xenbase ID: 17257725

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123150
Original XGC clone length: 1272

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: B10

Sequences - 5ʹ (forward) EST

Accession: JZ838081
dbEST ID: 79655783
Trimmed Sequence: ATGGCGCTGAAAGGGGCCTCCCTTCTGAGACGCTGGCCGAGTTTGCTTTCTAGATTTCCCACTGGCTCCTTCTCACAAACAACCGCTGCCAACCAGTCCAGCCTCCAGGCACAGACTTCCCTCTACACTCCGGATCACGTTGCCATAAGGGAGACCTTAAGAAAGATAATTGACACTGAGATTAACCCCTATGTCAACCAATGGGAGGAAGCAGGGCAGTTCCCAGCTCACAAGGTCTTCAAAATCCTTGGAAATGCTGGGCTACTGGGAGTCAATAAACCACCAGAATACGGCGGAATGGGCCTGGACTTTTCCTATAGTATTGCAGTTGCAGAGGAGCTTGGCAATATTCGCTGCGGTGGGGTCCCTATGGCCATCGGTGTTCAGTCAGACATGGCTACACCAGCTCTTACAAGGTTTGGCAGTGATGAATTGAAACGTCAGTTTCTTGCTCCAACCATTGCTGGAGATGTAGTCGTTTGTCTGGGAGTCAGTGAAGCAAGAGCTGGATCAGATGTGGCAAGTATTAAAACAACAACTGTGAAGAAAGAAGACGATTACATTATCATCAGCAGCAAGATGTGGACAAACCAATCGTTCCGAGCTGATTTAATGGCTTTGCTGCCCGGTCAATGCACGGGCCCCTCCGAAAAACAAATCACTTTTGTGGTTTTGTAGAATACCAATGGGTGCCGGTTTGGGGAACAAATTAAAAAAATTAGATGAAAGTCCCCGAGACCACCCTCAAAAAAAATTTTAAAAAAAGAAAAATTTTAAGCCACC
Full Trace Sequence: CGGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGAAAGGGGCCTCCCTTCTGAGACGCTGGCCGAGTTTGCTTTCTAGATTTCCCACTGGCTCCTTCTCACAAACAACCGCTGCCAACCAGTCCAGCCTCCAGGCACAGACTTCCCTCTACACTCCGGATCACGTTGCCATAAGGGAGACCTTAAGAAAGATAATTGACACTGAGATTAACCCCTATGTCAACCAATGGGAGGAAGCAGGGCAGTTCCCAGCTCACAAGGTCTTCAAAATCCTTGGAAATGCTGGGCTACTGGGAGTCAATAAACCACCAGAATACGGCGGAATGGGCCTGGACTTTTCCTATAGTATTGCAGTTGCAGAGGAGCTTGGCAATATTCGCTGCGGTGGGGTCCCTATGGCCATCGGTGTTCAGTCAGACATGGCTACACCAGCTCTTACAAGGTTTGGCAGTGATGAATTGAAACGTCAGTTTCTTGCTCCAACCATTGCTGGAGATGTAGTCGTTTGTCTGGGAGTCAGTGAAGCAAGAGCTGGATCAGATGTGGCAAGTATTAAAACAACAACTGTGAAGAAAGAAGACGATTACATTATCATCAGCAGCAAGATGTGGACAAACCAATCGTTCCGAGCTGATTTAATGGCTTTGCTGCCCGGTCAATGCACGGGCCCCTCCGAAAAACAAATCACTTTTGTGGTTTTGTAGAATACCAATGGGTGCCGGTTTGGGGAACAAATTAAAAAAATTAGATGAAAGTCCCCGAGACCACCCTCAAAAAAAATTTTAAAAAAAGAAAAATTTTAAGCCACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGAAAGGGGCCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ838080
dbEST ID: 79655782
Trimmed Sequence: CTTTTTACTTGGAAGTGTTCCCATGTATTTGCATATGATTGACAACATTACTTCATCCGCTCCTGCTCCTATCGACAACAGCCTTGAGTCTCGATAAAACCGACTAACAAGAACTTCATTGGTGAAACCCATTCCTCCCCAGAACTGAAGACAGCTGTCACTCAATTCTCGTGCAAGTCGGCCAGCTTTTAATTTAGCCATGGAAGCAAGTTTGGTGACATCATTACCTTCGACATACATTGCAACAGCACGATACAGCAGCGAGCGCAGAAGTTCAACTTCAGTTGCCAATTCTGCTAAGCGAAAGTGTACCACCTGGTTATGCAGCACTGGCTGGTTAAAGACTTTCCGTTGACTGGTATAGTCAATAGTTTCTTGTATGATGTTCTCCATTGTTGTCAGCACATTGGCTGCTCCCCACATGCGCTCCTCTTGGAATTGCAACATTTGGTATGTGAAGCCCATTCCTTCCTCGCCAATTAGATACTTGCTTGGAACTCTGACATCTTCAAAGAATATCTGAGCTGTGTCTGATGATTTCATGCCAATTTTCTCAATTTTTTTCGTAACCTGGACACCAGGTGTTTTCATAGGTAAACAAAAAAGTGACTTGTTTTCTGTGAGGTGGCCCTGCACTTGTGTTGGCAAGCAAGCACATCCCATCAGCCCGGGCACCCACTGGTTGGTCACACCTTGCCTCCCTTTGATAATGGTAATCGTCTCCCCTTTTTTCAAACCTTGTTTGTCCTAAAAAACTTGCCCAACATCTAAAAC
Full Trace Sequence: GTGTAAACCGCTATTGACCATGTAATACGACTCACTATANGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTTTACTTGGAAGTGTTCCCATGTATTTGCATATGATTGACAACATTACTTCATCCGCTCCTGCTCCTATCGACAACAGCCTTGAGTCTCGATAAAACCGACTAACAAGAACTTCATTGGTGAAACCCATTCCTCCCCAGAACTGAAGACAGCTGTCACTCAATTCTCGTGCAAGTCGGCCAGCTTTTAATTTAGCCATGGAAGCAAGTTTGGTGACATCATTACCTTCGACATACATTGCAACAGCACGATACAGCAGCGAGCGCAGAAGTTCAACTTCAGTTGCCAATTCTGCTAAGCGAAAGTGTACCACCTGGTTATGCAGCACTGGCTGGTTAAAGACTTTCCGTTGACTGGTATAGTCAATAGTTTCTTGTATGATGTTCTCCATTGTTGTCAGCACATTGGCTGCTCCCCACATGCGCTCCTCTTGGAATTGCAACATTTGGTATGTGAAGCCCATTCCTTCCTCGCCAATTAGATACTTGCTTGGAACTCTGACATCTTCAAAGAATATCTGAGCTGTGTCTGATGATTTCATGCCAATTTTCTCAATTTTTTTCGTAACCTGGACACCAGGTGTTTTCATAGGTAAACAAAAAAGTGACTTGTTTTCTGTGAGGTGGCCCTGCACTTGTGTTGGCAAGCAAGCACATCCCATCAGCCCGGGCACCCACTGGTTGGTCACACCTTGCCTCCCTTTGATAATGGTAATCGTCTCCCCTTTTTTCAAACCTTGTTTGTCCTAAAAAACTTGCCCAACATCTAAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTTTACTTGGAAGTGTTCCCAT