ORFeome > MGC154358 ORF1 – XORFeome v1.0

MGC154358 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6252444
Gene Page ID:
ORF Xenbase ID: 17257737

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC123160
Original XGC clone length: 603

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: E02

Sequences - 5ʹ (forward) EST

Accession: JZ838155
dbEST ID: 79655857
Trimmed Sequence: ATGTTCGGACGTCTGTGGACGAAGTACAATGCGGCATTGGAGACGAACCCTCTGCTGATCAAGGCTGTGACCTCCCTCACGGGCTTCACCCTCGGTGACATCCTCGCCCAGAAATTTGTTATGCCCGACAAGGAGAAGGGCTACGACTTGATGCGTACCGTCCGTCTGGGTTCCTTCGGCTTCCTTGTTCACGGACCCACCGGCCACTACTTCTACAGCTGGCTTGACAAGCAGATCCCGGGCACGGCCATGAAGACTGTTGCCACCAAGGTGGCTATCGATCAGCTCCTTTGGAACCCATGCTTCGGCGTCATGTTCTTCTCCTACCTCGGCTTGGCCGAGGGCAAGTCGTTTGCAGACATCCAGACTAAAATTAAAAACGATCTGACGACGGCGGTGGTGGGGTCGTGGACGGTGTGGATCCCTGCGCACTTTGTGAACTTCCGTTTTGTGCCTTCCACCCAGCGACTGCTCTACATCAACTCCATCCAAATTGGGTACAACATCTTCTTGTCCTTCCTAGGAAACAAAAAGGTCCATGAACCCGAGGTCGTGAAGGAGGCGGAGGGCGCCGTGACCTCGGCGCTGGACAAGAAGAAATTGCCAACTTTCCTGTAAAGGGTTGGCATTATGAAAAACATTGTTTTTAATTTTTTCCGGGAGGAGGGTACTAGCAGTCAAAATAAAATAATAATTTTTCAGTCCACTGGTTTCCCCAAAAAAAAAAAAAAAAAAAAAATATAAAAAATTTATTCGGTCCCCGCCGCGCCCGGCCACA
Full Trace Sequence: TCGGGGCCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTCGGACGTCTGTGGACGAAGTACAATGCGGCATTGGAGACGAACCCTCTGCTGATCAAGGCTGTGACCTCCCTCACGGGCTTCACCCTCGGTGACATCCTCGCCCAGAAATTTGTTATGCCCGACAAGGAGAAGGGCTACGACTTGATGCGTACCGTCCGTCTGGGTTCCTTCGGCTTCCTTGTTCACGGACCCACCGGCCACTACTTCTACAGCTGGCTTGACAAGCAGATCCCGGGCACGGCCATGAAGACTGTTGCCACCAAGGTGGCTATCGATCAGCTCCTTTGGAACCCATGCTTCGGCGTCATGTTCTTCTCCTACCTCGGCTTGGCCGAGGGCAAGTCGTTTGCAGACATCCAGACTAAAATTAAAAACGATCTGACGACGGCGGTGGTGGGGTCGTGGACGGTGTGGATCCCTGCGCACTTTGTGAACTTCCGTTTTGTGCCTTCCACCCAGCGACTGCTCTACATCAACTCCATCCAAATTGGGTACAACATCTTCTTGTCCTTCCTAGGAAACAAAAAGGTCCATGAACCCGAGGTCGTGAAGGAGGCGGAGGGCGCCGTGACCTCGGCGCTGGACAAGAAGAAATTGCCAACTTTCCTGTAAAGGGTTGGCATTATGAAAAACATTGTTTTTAATTTTTTCCGGGAGGAGGGTACTAGCAGTCAAAATAAAATAATAATTTTTCAGTCCACTGGTTTCCCCAAAAAAAAAAAAAAAAAAAAAATATAAAAAATTTATTCGGTCCCCGCCGCGCCCGGCCACA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCGGACGTCTGTGG

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGAAACCGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCATCTTGTCCACCGCCGAGGTCACGGCCGCCTCCGCCTCCTTCACGACCTCGGGTTCATCGACCTTCTTGTTTCCCATGAAGGACAACAACATGTTGTACCCCATTTGGATGGAGTTGATGTAAAGCAGTCCCTGGCTGGAACGCACAAAACGGAGCTTCACAAGGTGCGCAGGGATCCACACCGTCCACTACCCCACCACCGCCGTGCCTCAGATCGTTCTTAATCTTAGTCGGGATGTCTGCAAACGACTTGCCCTCGGCCAAGCCCTAGGTAGGAGAAGAACATCACGCCCAACCATGGGTTCCTAAGGAGCTGATCCATAGCCGCCTTGGTGGCAACAGTCTTCATGGCCGTGCCCGGGACCTGCTTGTCGGGCCAGCTGTAGAACTAGTGGGCCGGGGGTCCTTGAACAAACAGGCCGACGGAATCCACACGGACAGTACGCAGCTGGTCCTACCCCTTCCTCTTGTCGGGCGTAACAAATTTCGTGGGGGGAGCAGGTCCCCTGCGGTGAGCCGGGCGAGGGGAGGGGCCGGGCCATGAGCCGGCAGAAGAATGGGTCGCGCGACGGCGACAGTATAGTTCGTCCGCCAGACCTCAAAAGCAATAGGGCGGGGTTTATTTTTTTCGTGGAGGGCACTGGTGAGAAAGAGCGATAAACAAGCGGGGTTGATTGGTGTGTGGGGGCGGGGGGGGTTGGGGTTCTNNGGAGAAAAAAAAAAAAAAAAAAAAAAAGAAAATATATTAGGAGGAGGAGCGGCCGCGCGGACCAAGCGGACCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCATCTTGTCCACCGCC