ORFeome > MGC154410 ORF1 – XORFeome v1.0

MGC154410 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5799110
Gene Page ID: 5799088
ORF Xenbase ID: 17257749

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123185
Original XGC clone length: 900

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ838104
dbEST ID: 79655806
Trimmed Sequence: ATGAGTCGGCTGTTCCTGCTTTGTATTGCCCTGTGCCCAGACCTGCTTGGAGACATCACAGATTTCTATGAAGTGATTGTAGCAGATAGAATAACCAATGGAAGTTGCATTGGACAGGACCCAATCGGGACTTACAACCCTGCGTCAGAGACTAAATGTAACCTCCTGAACCTGGATTTAATGCCCAATGCCTTCGATGACCAGTACCAAGGCTGCGCTGAAGAACTGGAGATGAACATCATGCCAAAGGTCCTTAAGATGGAAATATCTCGGAACCCTGTGTTCGGGCTGGCTTGGAAACGAGCAGAAAAAGATTGGAATAAAGTGAAATCTACTTTGCGCCTTCCCCAGGGATTTACAGATCCTTTAGGGACTGCAATTCGGGTTTATACCACGGACTGGCCAGAGGGGAACCCACTTTACAAAGCCTTTAATGGCAATGTGAGCATGGCTGGGAAGTCCAGGGGACACTACATGGAGCACTTCAACTTCAAAGCTCTTCACTTCTACCTGACCAGAGCCTTGCAGGTGCTCAGACGGAACTCCAAGAGGCGATACCGCACCTACAGGGGAACAGATGACTCCTATGAGGTATCCTGAGGAGGTTCTGCGCTTTGGCAGGTTTACCTCGTCCTCACTCACCCTAGAGGTGGGTAGGGAGGTACACAGGGGACTTTTAGTTGAACTGAAACCCGGGTTTCGGGGGGGAAGGTGCGGGGGGAATTCCCCTTTTTCCCCTTTTTAATAAAAAATATTTATCCCGCGTTGCTCCAAACAGTGTTCATTTATATT
Full Trace Sequence: GACCCCATATAATAGATTTTATTTTNGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTCGGCTGTTCCTGCTTTGTATTGCCCTGTGCCCAGACCTGCTTGGAGACATCACAGATTTCTATGAAGTGATTGTAGCAGATAGAATAACCAATGGAAGTTGCATTGGACAGGACCCAATCGGGACTTACAACCCTGCGTCAGAGACTAAATGTAACCTCCTGAACCTGGATTTAATGCCCAATGCCTTCGATGACCAGTACCAAGGCTGCGCTGAAGAACTGGAGATGAACATCATGCCAAAGGTCCTTAAGATGGAAATATCTCGGAACCCTGTGTTCGGGCTGGCTTGGAAACGAGCAGAAAAAGATTGGAATAAAGTGAAATCTACTTTGCGCCTTCCCCAGGGATTTACAGATCCTTTAGGGACTGCAATTCGGGTTTATACCACGGACTGGCCAGAGGGGAACCCACTTTACAAAGCCTTTAATGGCAATGTGAGCATGGCTGGGAAGTCCAGGGGACACTACATGGAGCACTTCAACTTCAAAGCTCTTCACTTCTACCTGACCAGAGCCTTGCAGGTGCTCAGACGGAACTCCAAGAGGCGATACCGCACCTACAGGGGAACAGATGACTCCTATGAGGTATCCTGAGGAGGTTCTGCGCTTTGGCAGGTTTACCTCGTCCTCACTCACCCTAGAGGTGGGTAGGGAGGTACACAGGGGACTTTTAGTTGAACTGAAACCCGGGTTTCGGGGGGGAAGGTGCGGGGGGAATTCCCCTTTTTCCCCTTTTTAATAAAAAATATTTATCCCGCGTTGCTCCAAACAGTGTTCATTTATATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTCGGCTGTTCCTGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838103
dbEST ID: 79655805
Trimmed Sequence: TTGGTGACCAGAGATGCAAACAGGAACTTCTCGCTTTTCCTCTCCTAAGTAGGCACAGTTAAAGTAAGTGCACAGCTGGCAGGTGCTGTTCATGACATAGACATTATCCCTCCTCCCCAAGTAATGAAACTTCTCTGCCACGGGGATGAGAACTTCTCTCTCTTTGGGGAAAAAGGAAATCCTGTGGATATCCACCCCGAAACAGGTTGTCAGCTCAAATAAAAGTCCCTTGTGGTACTCTTTAGCCACCTCTACGTTCAGTGAGGACGAGGTAAACCTGCCAAAGCGCAGAACCTCCTCAGATACCTCATAGGAGTCATCTGTTCCCCTGTAGGTGCGGTATCGCCTCTTGGAGTTCCGTTTGAGCACCTGCAAGGCTCTGGTCAGGTAGAAGTGAAGAGCTTTGAAGTTGAAGTGCTCCATGTAATGTCCCCTGGACTTCCCAGCCATGCTCACATTGCCATTAAAGGCTTTGTAAAGTGGGTTCCCCTCTGGCCAGTCCGTGGTATAAACCCGAATTGCAGTCCCTAAAGGATCTGTAAATCCCTGGGGAAGGCGCAAAGTATATTTCACTTTATTCCAATCTTTTTCTGCTCGTTTCCGAGCCGACCCCAAACACCGGGGTTCCGAGAGATTTCCATCTTAAAGGACCTTTGGCCGGAAGTTTCGGCGCCGGGTTCTTCAACCCCATCCCTTGGTACCGGGGCCTCCAAAGGCATTTGGGCCATATAAATCCCAGGGTTCAAGAAAGGTTAAGGGTTTAAGTTCT
Full Trace Sequence: GAGGAAACAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGGTGACCAGAGATGCAAACAGGAACTTCTCGCTTTTCCTCTCCTAAGTAGGCACAGTTAAAGTAAGTGCACAGCTGGCAGGTGCTGTTCATGACATAGACATTATCCCTCCTCCCCAAGTAATGAAACTTCTCTGCCACGGGGATGAGAACTTCTCTCTCTTTGGGGAAAAAGGAAATCCTGTGGATATCCACCCCGAAACAGGTTGTCAGCTCAAATAAAAGTCCCTTGTGGTACTCTTTAGCCACCTCTACGTTCAGTGAGGACGAGGTAAACCTGCCAAAGCGCAGAACCTCCTCAGATACCTCATAGGAGTCATCTGTTCCCCTGTAGGTGCGGTATCGCCTCTTGGAGTTCCGTTTGAGCACCTGCAAGGCTCTGGTCAGGTAGAAGTGAAGAGCTTTGAAGTTGAAGTGCTCCATGTAATGTCCCCTGGACTTCCCAGCCATGCTCACATTGCCATTAAAGGCTTTGTAAAGTGGGTTCCCCTCTGGCCAGTCCGTGGTATAAACCCGAATTGCAGTCCCTAAAGGATCTGTAAATCCCTGGGGAAGGCGCAAAGTATATTTCACTTTATTCCAATCTTTTTCTGCTCGTTTCCGAGCCGACCCCAAACACCGGGGTTCCGAGAGATTTCCATCTTAAAGGACCTTTGGCCGGAAGTTTCGGCGCCGGGTTCTTCAACCCCATCCCTTGGTACCGGGGCCTCCAAAGGCATTTGGGCCATATAAATCCCAGGGTTCAAGAAAGGTTAAGGGTTTAAGTTCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGGTGACCAGAGATGCAAA