ORFeome > MGC154434 ORF1 – XORFeome v1.0

MGC154434 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 980735
Gene Page ID: 980730
ORF Xenbase ID: 17257755

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC123200
Original XGC clone length: 546

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: E10

Sequences - 5ʹ (forward) EST

Accession: JZ838323
dbEST ID: 79656025
Trimmed Sequence: ATGGAGACTTCACAATGGCAGAAAGCAATACTACTTTATCTGGCTCGTAAATATAAAACCCCTGATCACTGGTATCCATCGGATTTGCAGAAGCGTGCCCGTGTTGATGAATACCTCGCTTGGCAGCACACCAACACCAGACCCAACAGTGCTAAGGTCTTTTGGACGAAGTGTGTATCCCCAACCCTTCTAGGAAAGGAAGCCCCCCGTGAAAAACTTGATGCAGTACTGGCAGACTTTAACACTACCATGAAGAATCTGGAAGAGAAATTCCTGGGGAACAAACCCTTCATTGCTGGGGATGAGATCTCTGTGGCAGACCTGGTGGCCATTGTTGAAATTATGCAGGTAATTGCAGGTGGTGTGAATGTGTTTGAAGAGCGGCCAAAGCTGGGAGCCTGGAAGCAGCAAGTAGTAGAGGCAGTGGGAGAAGACCTCTTTCAGGAGGCACATGAGTGGATTCTCAGTTTCAGCAAACAAAAATTTGAACCACTCCCAGCTGAGCTACTGCAGCGCCTGAAGAGCAGCCCACTTTATAAGGACTT
Full Trace Sequence: TCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGACTTCACAATGGCAGAAAGCAATACTACTTTATCTGGCTCGTAAATATAAAACCCCTGATCACTGGTATCCATCGGATTTGCAGAAGCGTGCCCGTGTTGATGAATACCTCGCTTGGCAGCACACCAACACCAGACCCAACAGTGCTAAGGTCTTTTGGACGAAGTGTGTATCCCCAACCCTTCTAGGAAAGGAAGCCCCCCGTGAAAAACTTGATGCAGTACTGGCAGACTTTAACACTACCATGAAGAATCTGGAAGAGAAATTCCTGGGGAACAAACCCTTCATTGCTGGGGATGAGATCTCTGTGGCAGACCTGGTGGCCATTGTTGAAATTATGCAGGTAATTGCAGGTGGTGTGAATGTGTTTGAAGAGCGGCCAAAGCTGGGAGCCTGGAAGCAGCAAGTAGTAGAGGCAGTGGGAGAAGACCTCTTTCAGGAGGCACATGAGTGGATTCTCAGTTTCAGCAAACAAAAATTTGAACCACTCCCAGCTGAGCTACTGCAGCGCCTGAAGAGCAGCCCACTTTATAAGGACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGGCAAAAAATATTCCAGACAACTTCTGCCCCTGTCTCATACCTCCCTGAAGGGTAAAAAAAAAAAAAATTTCCTCCCCCCGGGGGGGGGGGTGTTGTTCTGTGGGTTTGTGGTTGAAGAGAACACCCCCCCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGACTTCACAATGGCAGAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838322
dbEST ID: 79656024
Trimmed Sequence: GTCCTTATAAAGTGGGCTGCTCTTCAGGCGCTGCAGTAGCTCAGCTGGGAGTGGTTCAAATTTTTGTTTGCTGAAACTGAGAATCCACTCATGTGCCTCCTGAAAGAGGTCTTCTCCCACTGCCTCTACTACTTGCTGCTTCCAGGCTCCCAGCTTTGGCCGCTCTTCAAACACATTCACACCACCTGCAATTACCTGCATAATTTCAACAATGGCCACCAGGTCTGCCACAGAGATCTCATCCCCAGCAATGAAGGGTTTGTTCCCCAGGAATTTCTCTTCCAGATTCTTCATGGTAGTGTTAAAGTCTGCCAGTACTGCATCAAGTTTTTCACGGGGGGCTTCCTTTCCTAGAAGGGTTGGGGATACACACTTCGTCCAAAAGACCTTAGCACTGTTGGGTCTGGTGTTGGTGTGCTGCCAAGCGAGGTATTCATCAACACGGGCACGCTTCTGCAAATCCGATGGATACCAGTGATCAGGGGTTTTATATTTACCAACCAAATAAAGTAGTATTGCTTTCTGCCATTGTGAAGTCTCCCGGG
Full Trace Sequence: GGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCCTTATAAAGTGGGCTGCTCTTCAGGCGCTGCAGTAGCTCAGCTGGGAGTGGTTCAAATTTTTGTTTGCTGAAACTGAGAATCCACTCATGTGCCTCCTGAAAGAGGTCTTCTCCCACTGCCTCTACTACTTGCTGCTTCCAGGCTCCCAGCTTTGGCCGCTCTTCAAACACATTCACACCACCTGCAATTACCTGCATAATTTCAACAATGGCCACCAGGTCTGCCACAGAGATCTCATCCCCAGCAATGAAGGGTTTGTTCCCCAGGAATTTCTCTTCCAGATTCTTCATGGTAGTGTTAAAGTCTGCCAGTACTGCATCAAGTTTTTCACGGGGGGCTTCCTTTCCTAGAAGGGTTGGGGATACACACTTCGTCCAAAAGACCTTAGCACTGTTGGGTCTGGTGTTGGTGTGCTGCCAAGCGAGGTATTCATCAACACGGGCACGCTTCTGCAAATCCGATGGATACCAGTGATCAGGGGTTTTATATTTACCAACCAAATAAAGTAGTATTGCTTTCTGCCATTGTGAAGTCTCCCGGGTGCCAACTTTCTTGTACAAGGTTGGCATTATAAAAAAACATTGCTAATCAATTTGTTGCAACGAAAGAGGTCACTATAGGTAAAAATAAATCATTAAAAAAAAAAAAAAAAATAAATAAGAACCTCCATTTCCAAAGACCCCGGCGCCGGAAAAAAAACAAAGTGGCTCCTCCACAAGGGGGGCGGGGTGATTGTCTCTCTGGTGGGATGGGGGGAGGGAACCACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCCTTATAAAGTGGGCTG