ORFeome > MGC154492 ORF1 – XORFeome v1.0

MGC154492 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5947786
Gene Page ID: 5947741
ORF Xenbase ID: 17257779

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123242
Original XGC clone length: 894

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ838245
dbEST ID: 79655947
Trimmed Sequence: ATGGCTTTGCCAACACTGTCCCCCGCGAATGGAACTTACTGCCAAGACGGAATACAGTGGATTTTAAATGTGTTTGGCGAGTGCGCAGTGAATGGGCGGGATTACGCCAGCGTGTATCTGGGTGTGATCTCCATGGGGTGTTTCATGGTTTGCACTTTCCCACAGTTCTATGAAGCCTTCAAGACTAAAAAGATGCACGAGGCAATGTCCTTATGGTTTGTCCTGCTCTGGCTGCTCGCCGACACCTTAAACCTCACTGGGACTTACCTTGCCAACCAGCTCCCCCTACAGAAATACTTTTGCATCTACTTTGTTGTGAACGACTGTCTGATGCTTGTAGTCTATCTCTACTTCAAGTTCCAGGACAGCAAACCCAAAACTTACACTGCCTTACCCGCTGTTTGTGGATTTGCCCTTCTGGGCTCTGTGGCCACTTTCTCCCTCCATCAGGAGTCAGAACCAACTGTGCTGAACCCCGGGAATGTGATACCCAGCCGGCACCTGCTCTCTGCTGATGGGAATGAGGAGAATTCTGTCCGGATGGCGGTTGGTTTTGCCTGTGGAATAATCGCGTACGCAATATGTCTCGTCTTCCGGATTCCCCAAATTGTGAGCAACTTTAAAAGGAAACAGTGGAAGGTTTGGCCCTGGGTATGGTCCTGTTCTTTATGGTGGGAAAAATCTTTCTACGAACGATTATTGTTATCAGGAACCCAAAAAAAAGGAAAAAAGAAAACCCGTGGAAACCCCAAAACCATCCGCCCCGGAATCAAAGGCGGGCACGGGGTGGTTTTTTTCCCCAATTTTATTTTTTTATTTTTA
Full Trace Sequence: GGAGGGCCCCAATAANTGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTTGCCAACACTGTCCCCCGCGAATGGAACTTACTGCCAAGACGGAATACAGTGGATTTTAAATGTGTTTGGCGAGTGCGCAGTGAATGGGCGGGATTACGCCAGCGTGTATCTGGGTGTGATCTCCATGGGGTGTTTCATGGTTTGCACTTTCCCACAGTTCTATGAAGCCTTCAAGACTAAAAAGATGCACGAGGCAATGTCCTTATGGTTTGTCCTGCTCTGGCTGCTCGCCGACACCTTAAACCTCACTGGGACTTACCTTGCCAACCAGCTCCCCCTACAGAAATACTTTTGCATCTACTTTGTTGTGAACGACTGTCTGATGCTTGTAGTCTATCTCTACTTCAAGTTCCAGGACAGCAAACCCAAAACTTACACTGCCTTACCCGCTGTTTGTGGATTTGCCCTTCTGGGCTCTGTGGCCACTTTCTCCCTCCATCAGGAGTCAGAACCAACTGTGCTGAACCCCGGGAATGTGATACCCAGCCGGCACCTGCTCTCTGCTGATGGGAATGAGGAGAATTCTGTCCGGATGGCGGTTGGTTTTGCCTGTGGAATAATCGCGTACGCAATATGTCTCGTCTTCCGGATTCCCCAAATTGTGAGCAACTTTAAAAGGAAACAGTGGAAGGTTTGGCCCTGGGTATGGTCCTGTTCTTTATGGTGGGAAAAATCTTTCTACGAACGATTATTGTTATCAGGAACCCAAAAAAAAGGAAAAAAGAAAACCCGTGGAAACCCCAAAACCATCCGCCCCGGAATCAAAGGCGGGCACGGGGTGGTTTTTTTCCCCAATTTTATTTTTTTATTTTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTTGCCAACACTGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ838244
dbEST ID: 79655946
Trimmed Sequence: GGGACAGATGGGACCGTTGGACTCCAGAAGCGGCGACTTCTCTTCAGAATCTTTCCTTGGTCTATAACTGGCAAACTGATACATACAAATAACATCGAGAAAAAACAACATGATGCAGCCTATGATCCAGGGCAGATGATTTAGAGCTTCACTGGCGTCCGTCTGTCCTTCCTCTGGGCTCTTGATAACAATACTCAGTCCGTAGAAGATGTTTCCCACCATAATGAACAGGAACATACCCAGGGCCAAACCTTCCACTGATTTCCTCTTAAAGTTGCTCACAATCTGGGGAATCCGGAAGACGAGACATATTGCGTACGCGATTATTCCACAGGCAAAACCAACCGCCATCCGGACAGAATTCTCCTCATTCCCATCAGCAGAGAGCAGGTGCCGGCTGGGTATCACATTCCCGGGGTTCAGCACAGTTGGTTCTGACTCCTGATGGAGGGAGAAAGTGGCCACAGAGCCCAGAAGGGCAAATCCACAAACAGCGGGTAAGGCAGTGTAAGTTTTGGGTTTGCTGTCCTGGAACTTGAAGTAGAGATAGACTACAAGCATCAAACAGTCGTTCACAACAAAATAAATGCAAAAGTATTTCTGTAAGGGGGAGCTGGGTTGGGCAGGTAAGTCCCAGTGAAGTTTAAGGTGTCGGCCAACCACCCAAAAAAAGAACAAACCTAAGGGAACTTGCCCTCCGGGATCCTCCTTAGTTCTTTAAAAGGCTTCATGAAAAACTGGTGGGGAAAGGGTGCAAGACGGATGAAAAACCCCC
Full Trace Sequence: GAAACTGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGGACAGATGGGACCGTTGGACTCCAGAAGCGGCGACTTCTCTTCAGAATCTTTCCTTGGTCTATAACTGGCAAACTGATACATACAAATAACATCGAGAAAAAACAACATGATGCAGCCTATGATCCAGGGCAGATGATTTAGAGCTTCACTGGCGTCCGTCTGTCCTTCCTCTGGGCTCTTGATAACAATACTCAGTCCGTAGAAGATGTTTCCCACCATAATGAACAGGAACATACCCAGGGCCAAACCTTCCACTGATTTCCTCTTAAAGTTGCTCACAATCTGGGGAATCCGGAAGACGAGACATATTGCGTACGCGATTATTCCACAGGCAAAACCAACCGCCATCCGGACAGAATTCTCCTCATTCCCATCAGCAGAGAGCAGGTGCCGGCTGGGTATCACATTCCCGGGGTTCAGCACAGTTGGTTCTGACTCCTGATGGAGGGAGAAAGTGGCCACAGAGCCCAGAAGGGCAAATCCACAAACAGCGGGTAAGGCAGTGTAAGTTTTGGGTTTGCTGTCCTGGAACTTGAAGTAGAGATAGACTACAAGCATCAAACAGTCGTTCACAACAAAATAAATGCAAAAGTATTTCTGTAAGGGGGAGCTGGGTTGGGCAGGTAAGTCCCAGTGAAGTTTAAGGTGTCGGCCAACCACCCAAAAAAAGAACAAACCTAAGGGAACTTGCCCTCCGGGATCCTCCTTAGTTCTTTAAAAGGCTTCATGAAAAACTGGTGGGGAAAGGGTGCAAGACGGATGAAAAACCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGGACAGATGGGACCGTT