ORFeome > MGC154500 ORF1 – XORFeome v1.0

MGC154500 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6252781
Gene Page ID:
ORF Xenbase ID: 17257785

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123246
Original XGC clone length: 1395

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: D02

Sequences - 5ʹ (forward) EST

Accession: JZ838218
dbEST ID: 79655920
Trimmed Sequence: ATGGCGGACGGGGCCGATCTGATTGATATTTACGCCGAGGAGGAGTTCATCCAGGTGGGGGAGACCCGGAGCGGCTCAAAGAGAAATGAGTCGGAGTTTGCTGCTGAGCAGGTAGACCTGTATGACGATGTGTTGGCTGTGCCGGCAATTTCTTCCCTGTACACTGATGGCAACAGAAACATCAGCTCCCTGGAAGCACCATCTCCCATACAGAGCACCTCTCCTAAGTCATACAACAAGACTTCTGAAATCCTGTACCTCGGTGGGCGCAACAGGGTGTCCATGTACATTGGGAACTTCTCGTGGTGGACAACAGATCAGCAGCTGCTCACTCTGATCCGTTCCCTGGGCATCAAAGATCATGTGGAAATAAAATTTGCAGAGAATAGAGCTAATGGCCAGTCCAAAGGGTTTGCAGAGGTCACTCTCTCCTCTGAATCCTCCATGAATCTTATACTCGAGCATTTGCCTCAGAAGAAGCTGAATGGGAAGAAGCTGGATGTGCGACCAGCCAATCGGCAGAACTTGTCCTTCTTTGAAGCACTTTCACGCAAGAAGATTCCACCCCGAGCAAATTCAAAGAGCTCTTCAGATTTGACAGACGGGTCTTCCGCACTACGCGAGCCTGCCATGTTGCTCCTCCCGCCAAGGCTCCAAAAGGATCAGGCCGTTGCTCTCCACACCTCCCATTTTGAAGCGGCGTTCTGCATCCCTGGCCAGACCCGTCCAAAATCCCACTAGAGCTCTTCCCCCTCCCCCCCCCCCCGAGCCTCCCCACAATGGAAGGGGGGGCTTGGGGGGGCG
Full Trace Sequence: TCGTGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGACGGGGCCGATCTGATTGATATTTACGCCGAGGAGGAGTTCATCCAGGTGGGGGAGACCCGGAGCGGCTCAAAGAGAAATGAGTCGGAGTTTGCTGCTGAGCAGGTAGACCTGTATGACGATGTGTTGGCTGTGCCGGCAATTTCTTCCCTGTACACTGATGGCAACAGAAACATCAGCTCCCTGGAAGCACCATCTCCCATACAGAGCACCTCTCCTAAGTCATACAACAAGACTTCTGAAATCCTGTACCTCGGTGGGCGCAACAGGGTGTCCATGTACATTGGGAACTTCTCGTGGTGGACAACAGATCAGCAGCTGCTCACTCTGATCCGTTCCCTGGGCATCAAAGATCATGTGGAAATAAAATTTGCAGAGAATAGAGCTAATGGCCAGTCCAAAGGGTTTGCAGAGGTCACTCTCTCCTCTGAATCCTCCATGAATCTTATACTCGAGCATTTGCCTCAGAAGAAGCTGAATGGGAAGAAGCTGGATGTGCGACCAGCCAATCGGCAGAACTTGTCCTTCTTTGAAGCACTTTCACGCAAGAAGATTCCACCCCGAGCAAATTCAAAGAGCTCTTCAGATTTGACAGACGGGTCTTCCGCACTACGCGAGCCTGCCATGTTGCTCCTCCCGCCAAGGCTCCAAAAGGATCAGGCCGTTGCTCTCCACACCTCCCATTTTGAAGCGGCGTTCTGCATCCCTGGCCAGACCCGTCCAAAATCCCACTAGAGCTCTTCCCCCTCCCCCCCCCCCCGAGCCTCCCCACAATGGAAGGGGGGGCTTGGGGGGGCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGACGGGGCCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838217
dbEST ID: 79655919
Trimmed Sequence: GCGGTGTCGATCCTTGTCGCGATGTCGCTCTTGGTAATATTCATCCGATCGGTCGTGCGAGTCTCTGTGACGCCGGCTGCTGCCTTCCCTTGATCGGCTAGGAGATCTGTCTCTGGAGCGGTGTCTCTTCCTGGAAGAGTTGGCTTTGTCCTGAATCCCATGCAAACAGTCTTTGAGGGAGGCAAGCAGGACCCGGCAGCGATCGTCATTGGCCACACGAGACTCCTTAATCACAGCAATGGCTGTTTCTAGAGTTTTGATGGCGTTTGCATAATCCCCTGAAGTTGCCCCGCATACAGCGTTCGAGAGCGCGCTCCTAGAGATTGCACGGTTTCTGTTCATTAACTCTTCAAACTCTGCGTCACTTACTGGAGGATACGGACCTTTCGGATCTCGGCTATGTATATAGGNGGTGGGGAATCATCTTGAATGGTTCCGGCGGGGGACAAAGGACAGAATTGGGAGGGGGAAAGAAGGCAGGGTTTAGATGGAGGGGAAGGTGGTACACTGCCAGGTGGAGGCATGCCTAATGGAGGCGGCAGCAGCCTGGGAGGTGGAGGCATTAAATGGGTATAGTGTAGAGGGGGAAATAAGGGGGTTGCCCGGTACGCAACATGCAATGATGGAATACTGGACTAGCACCAAAAAAAAAAAAAAATGGTTAAAATTTGGAAGGGGTGGTGACGGGGGAGAACAAAAACAGAAACCTCCAACACTTCCCACCT
Full Trace Sequence: GGAATTATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCGGTGTCGATCCTTGTCGCGATGTCGCTCTTGGTAATATTCATCCGATCGGTCGTGCGAGTCTCTGTGACGCCGGCTGCTGCCTTCCCTTGATCGGCTAGGAGATCTGTCTCTGGAGCGGTGTCTCTTCCTGGAAGAGTTGGCTTTGTCCTGAATCCCATGCAAACAGTCTTTGAGGGAGGCAAGCAGGACCCGGCAGCGATCGTCATTGGCCACACGAGACTCCTTAATCACAGCAATGGCTGTTTCTAGAGTTTTGATGGCGTTTGCATAATCCCCTGAAGTTGCCCCGCATACAGCGTTCGAGAGCGCGCTCCTAGAGATTGCACGGTTTCTGTTCATTAACTCTTCAAACTCTGCGTCACTTACTGGAGGATACGGACCTTTCGGATCTCGGCTATGTATATAGGNGGTGGGGAATCATCTTGAATGGTTCCGGCGGGGGACAAAGGACAGAATTGGGAGGGGGAAAGAAGGCAGGGTTTAGATGGAGGGGAAGGTGGTACACTGCCAGGTGGAGGCATGCCTAATGGAGGCGGCAGCAGCCTGGGAGGTGGAGGCATTAAATGGGTATAGTGTAGAGGGGGAAATAAGGGGGTTGCCCGGTACGCAACATGCAATGATGGAATACTGGACTAGCACCAAAAAAAAAAAAAAATGGTTAAAATTTGGAAGGGGTGGTGACGGGGGAGAACAAAAACAGAAACCTCCAACACTTCCCACCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGGTGTCGATCCTTGT