ORFeome > MGC154518 ORF1 – XORFeome v1.0

MGC154518 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6252779
Gene Page ID:
ORF Xenbase ID: 17257797

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123254
Original XGC clone length: 993

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: H07

Sequences - 5ʹ (forward) EST

Accession: JZ838801
dbEST ID: 79656503
Trimmed Sequence: ATGCTTTCTGGGCGCACTAGCCGGTTTATTCAGACGGGCGTGCTGCGGCGCCTGCAGAGCACCCTGGTGGTGGCCGAACATGCCGACAACAAGCTGAGCGCGGCTACCCTCAGCGCCGTCACCGCCGCCAGGCAGGTCGGACAGGATGTCACCTGCATCGTCGCAGGAGCAGACTGCAAACAGGTGGCCGCTGAGCTGTCGAAGGTGGGCGGCGTGACCAAGCTGCTGGTGGCCGAGGATGCCGCGCTCGAGGGCCTCCTGCCCGAGCGCGTGGCGCCCCTGCTCCTGGCCGCTCAGAAACAGTTCAACTTCTCGCACATCATTGCCGGCGCCACGGCGTTCGGCAAGTCTGTGCTGCCGCGGGTGGCCGCCAAGCTGGACGTGTCGCCAATCTCTGACGTCACTGGCATCCAGTCGGCCGACACGTTCGTACGCACCATCTACGCCGGTAACGCCATCATGACGTTCAAGTCGAATGACGCGGTGAAGGTGGTGACTGTTCGCGGCACCAACTTCAAAACGGCGAAGGTGGGCGGCGGGCGTCGCGGCGCCCCATGTGATGGCGGTAAAAAGCATGGAGAAAGAAAGCTTCCCCCCTACAATGGAGGAAGGAGCAAAGCAAAAACGAGCCGGCGCGGAACGCCCCTGCTGCCGGAAAACTACATCTCCACGCGGCGGGCGGTCTGAACATCAAGAGACGGAGGTTGAAAGTGTAGTATGGAAGTGGGGTTGGGGAGCAGGAGGGCTGTGGGGGGTGGACGGGAAAAAGACAACCAGGGGAACGGCCTGGACCGCCGTATACGTACGGCTACGATAGTGGGTAAGACTAT
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTTTCTGGGCGCACTAGCCGGTTTATTCAGACGGGCGTGCTGCGGCGCCTGCAGAGCACCCTGGTGGTGGCCGAACATGCCGACAACAAGCTGAGCGCGGCTACCCTCAGCGCCGTCACCGCCGCCAGGCAGGTCGGACAGGATGTCACCTGCATCGTCGCAGGAGCAGACTGCAAACAGGTGGCCGCTGAGCTGTCGAAGGTGGGCGGCGTGACCAAGCTGCTGGTGGCCGAGGATGCCGCGCTCGAGGGCCTCCTGCCCGAGCGCGTGGCGCCCCTGCTCCTGGCCGCTCAGAAACAGTTCAACTTCTCGCACATCATTGCCGGCGCCACGGCGTTCGGCAAGTCTGTGCTGCCGCGGGTGGCCGCCAAGCTGGACGTGTCGCCAATCTCTGACGTCACTGGCATCCAGTCGGCCGACACGTTCGTACGCACCATCTACGCCGGTAACGCCATCATGACGTTCAAGTCGAATGACGCGGTGAAGGTGGTGACTGTTCGCGGCACCAACTTCAAAACGGCGAAGGTGGGCGGCGGGCGTCGCGGCGCCCCATGTGATGGCGGTAAAAAGCATGGAGAAAGAAAGCTTCCCCCCTACAATGGAGGAAGGAGCAAAGCAAAAACGAGCCGGCGCGGAACGCCCCTGCTGCCGGAAAACTACATCTCCACGCGGCGGGCGGTCTGAACATCAAGAGACGGAGGTTGAAAGTGTAGTATGGAAGTGGGGTTGGGGAGCAGGAGGGCTGTGGGGGGTGGACGGGAAAAAGACAACCAGGGGAACGGCCTGGACCGCCGTATACGTACGGCTACGATAGTGGGTAAGACTAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTTTCTGGGCGCACT

Sequences - 3ʹ (reverse) EST

Accession: JZ838800
dbEST ID: 79656502
Trimmed Sequence: CAGCTTCTCAGTCATCTCTGGCACGGCTTTGAACAGGTCAGCGACCAGGCCCAGATCCGCCACCTGGAAGATAGGCGCCTCCGGGTCCTTGTTGATGGCCACGATGGTCTTCGAGTCCTTCATGCCGGCCAGATGCTGAATCGCGCCAGAGATACCGACAGCGATGTACAGGTCCGGTGCGATGATCTTGCCGGTCTGCCCGACCTGCATGTCATTGGGCACGAAGCCGGCGTCCACGGCGGCACGGGAGGCGCCCACCGCAGCCTTCAGCTTGTCCGCCAGCTTGTACAGCAGCTCAAAGTTCTCGCCAGACTTCAGACCGCGACCGCCGCTGACGACGTTTCCGGCGCTGGTGAGTTCGGGCCGGTCGCTCTTGCTCAGCTCCTGCCCCACGTAGGCGGACGCATCCTTGTCCATGCCTTCTACAGCCATCACCTCGGGCGCCGCGCCGCCGCCGGCCACCTCCGTCGGGTCGAAGCTGGTGGCGCGAGCAGTCACCACCTTCACCGCGTCGTTCCAACTGAACGTCATGAACGCGGTACCCTCGCAAAATGTGCGGACGACAGGTCCAGCTGACTGCATGGCGATGACGTCCGAAAATGAAGAACCGTCCAGCCTGGGGGGCCGGCGGCGGACACAACAGAGATACCAAAATGCCGAGGTCCCCGGGCGGTGTTGGGCAAAAAGAGAGAATGATGTTCGAAACCGACCCGGAAAGGAGGGGGCGACCGGGCGGGCGGGGAACCAGAGAGAGCGGGGGGAAAG
Full Trace Sequence: GGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGCTTCTCAGTCATCTCTGGCACGGCTTTGAACAGGTCAGCGACCAGGCCCAGATCCGCCACCTGGAAGATAGGCGCCTCCGGGTCCTTGTTGATGGCCACGATGGTCTTCGAGTCCTTCATGCCGGCCAGATGCTGAATCGCGCCAGAGATACCGACAGCGATGTACAGGTCCGGTGCGATGATCTTGCCGGTCTGCCCGACCTGCATGTCATTGGGCACGAAGCCGGCGTCCACGGCGGCACGGGAGGCGCCCACCGCAGCCTTCAGCTTGTCCGCCAGCTTGTACAGCAGCTCAAAGTTCTCGCCAGACTTCAGACCGCGACCGCCGCTGACGACGTTTCCGGCGCTGGTGAGTTCGGGCCGGTCGCTCTTGCTCAGCTCCTGCCCCACGTAGGCGGACGCATCCTTGTCCATGCCTTCTACAGCCATCACCTCGGGCGCCGCGCCGCCGCCGGCCACCTCCGTCGGGTCGAAGCTGGTGGCGCGAGCAGTCACCACCTTCACCGCGTCGTTCCAACTGAACGTCATGAACGCGGTACCCTCGCAAAATGTGCGGACGACAGGTCCAGCTGACTGCATGGCGATGACGTCCGAAAATGAAGAACCGTCCAGCCTGGGGGGCCGGCGGCGGACACAACAGAGATACCAAAATGCCGAGGTCCCCGGGCGGTGTTGGGCAAAAAGAGAGAATGATGTTCGAAACCGACCCGGAAAGGAGGGGGCGACCGGGCGGGCGGGGAACCAGAGAGAGCGGGGGGAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGCTTCTCAGTCATCTC