ORFeome > MGC154789 ORF1 – XORFeome v1.0

MGC154789 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6252461
Gene Page ID:
ORF Xenbase ID: 17257803

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126015
Original XGC clone length: 918

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: E07

Sequences - 5ʹ (forward) EST

Accession: JZ837386
dbEST ID: 79655088
Trimmed Sequence: ATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACCATCACCTTGGAGGTGGAGCCCAGTGACACCATCGAGAATGTGAAGGCCAAGATCCAGGATAAAGAGGGCATCCCCCCTGACCAGCAGAGGCTGATCTTTGCCGGCAAGCAGCTAGAAGATGGCCGCACTCTCTCTGATTACAACATCCAGAAAGAGTCGACCCTGCACCTGGTCCTCCGTCTGAGGGGTGGCTATTT
Full Trace Sequence: CTTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACCATCACCTTGGAGGTGGAGCCCAGTGACACCATCGAGAATGTGAAGGCCAAGATCCAGGATAAAGAGGGCATCCCCCCTGACCAGCAGAGGCTGATCTTTGCCGGCAAGCAGCTAGAAGATGGCCGCACTCTCTCTGATTACAACATCCAGAAAGAGTCGACCCTGCACCTGGTCCTCCGTCTGAGGGGTGGCTATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTAAAAAAAAAAAAAGAAACAAATTATCTTGAAAAATGAAACACAAGGGAGACAAAAAACAAGACGTCCCCTCAACCCCCGGGGCCGGGGTGTTCCCTTTTTTTTTGTTAGAAAGGGGTCCCGGGGGAGAAAACCCCGGGGGAAGGGGTTGAGGGTTTAGAATAAAGGGAAAGAACCCCGGGCCGGGTCAAAAAACTTAAAAAAAAAAAGGGGGGGGGGGCGGGGGGGGGGGTTGTTCAAAATTTTTTAACCAATTTTTTGGTTGTGGGATTCCCGCCCACCGGGCCCCTCTCCCCCGGCGTCCCTCCGCGGGTTGTTTTTTTTGGGGGAACGACACCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCTTTCCCCTCCTGGTGGGTGTGGAGTGTTTTTTTGTTGTTTTTTGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGATCTTCGTGAAGACC

Sequences - 3ʹ (reverse) EST

Accession: JZ837385
dbEST ID: 79655087
Trimmed Sequence: ATAGCCACCCCTCAGACGGAGGACCAGGTGCAGGGTCGACTCTTTCTGGATGTTGTAATCAGAGAGAGTGCGGCCATCTTCTAGCTGCTTGCCGGCAAAGATCAGCCTCTGCTGGTCAGGGGGGATGCCCTCTTTATCCTGGATCTTGGCCTTCACATTCTCGATGGTGTCACTGGGCTCCACCTCCAAGGTGATGGTCTTGCCGGTCAGGGTCTTCACGAAGATCTGCATGG
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATAGCCACCCCTCAGACGGAGGACCAGGTGCAGGGTCGACTCTTTCTGGATGTTGTAATCAGAGAGAGTGCGGCCATCTTCTAGCTGCTTGCCGGCAAAGATCAGCCTCTGCTGGTCAGGGGGGATGCCCTCTTTATCCTGGATCTTGGCCTTCACATTCTCGATGGTGTCACTGGGCTCCACCTCCAAGGTGATGGTCTTGCCGGTCAGGGTCTTCACGAAGATCTGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAGGACTGACCGTCGAAAAAAAAAAACAAAAGAAAAATTTAACTTGGAAATACGACAACCGCGGGGGCATAAAACAAAGAGTCGGCTCCGCCCCAGGGCCGTTTGGTTTGCTTTGTTGGAATGGGAAAGGTGGCAATCCAAACAAACGGTGCGGGGGGGGGGAAGCCGGTACGAAAAAAAACACACCCCTCCCGGGATCGGATATAAAATTAGCAAAAACCAGGGGTGGGGGGGGGGGGGGGGGGTTTTTGTTTTTTTGTTATAATTTTTTTTGTTGTATTCCTCTGCGCCCCNNGTCCCACCACAGCCACCGGCGGCTTCGTTTGGGGGTGGGTAGTGTGGGATGAGGAACAAGACCGCCACCAAGNGGGACCGCGGGNCCGCCGCGGGNGGATAGTTTTATTTTTTTTGTAGGNGTGGTGAAAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAGCCACCCCTCAGAC