ORFeome > MGC154829 ORF1 – XORFeome v1.0

MGC154829 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6252460
Gene Page ID:
ORF Xenbase ID: 17257821

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126024
Original XGC clone length: 2115

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: B12

Sequences - 5ʹ (forward) EST

Accession: JZ837396
dbEST ID: 79655098
Trimmed Sequence: ATGGAGAAATTAGGAATGAGCTTTGGAGGTGGTCCAAGTAAGAAAGAACTTCAGGAGTTGGTAGAGACTCAACGGAAACAACTACAACAGTACCAGGTGCGACTGAAGGATGTTGTGCGAGCATATAAGAGTCTTCAAAAAGAAAAGGAGGCCCTTGAGGCCAGTATCCATGTCCTTTCCACTACTCAGGAGCCAGCAACTGTTATCTCAGAATCTGAAGAGACTAATGATGACCAGCATTCTATACATAGTGAGGATAGTGTTGACACGGCAGGAAGCCATAGGTT
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGAAATTAGGAATGAGCTTTGGAGGTGGTCCAAGTAAGAAAGAACTTCAGGAGTTGGTAGAGACTCAACGGAAACAACTACAACAGTACCAGGTGCGACTGAAGGATGTTGTGCGAGCATATAAGAGTCTTCAAAAAGAAAAGGAGGCCCTTGAGGCCAGTATCCATGTCCTTTCCACTACTCAGGAGCCAGCAACTGTTATCTCAGAATCTGAAGAGACTAATGATGACCAGCATTCTATACATAGTGAGGATAGTGTTGACACGGCAGGAAGCCATAGGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTACAGTGAGTCATATTACATGGTCATAACTGTTTCCTGGCAGCTCTGGCAAGTGACTCAAAATCTGTCATGTTACACAATTACNCGAGACAATTCACAAAAAGGAAGCTTCCAATCAAGCAAATAAAAGGAATGTAGAGCAGGGCACCGAGGAGTTGATGCCCAACATGCAAGGAGCGAAAAACCATTGGCTGTAAGAACTTCAAAATCTCCCAGGAGCAACTTACAAATACGCAGGGGCAAAATAAAAAACTCGCAAGCATGACCTTGCTCAAGAGCAAGTAAACCTAGGCTATTATGGTAAAAAAACTTTCAACGACCCTACCCAGGAGAAACAAAAACCAGCCTTCCAGAACACAAGAACTTCCGGGCTTGGAAGGAATCCGGGAAAGGAAAACCAACAAAAAGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGAAATTAGGAATGAGCTTT

Sequences - 3ʹ (reverse) EST

Accession: JZ837395
dbEST ID: 79655097
Trimmed Sequence: CCTCTTGCTTCCTGCCCACCACCTATTCCCCTCCCGTGCACGCAAAGCTGCATTTCCTTCCTCAGGATAAAAATGCAACACTGCAAGCACAGCACTCAGTGTATGCTGTCTTCCTCTGGGATCTGGCAAGGTCAAATATCCTAATAATACATTTTTCAAATACTCCATGTTTGCCCCCTCCCTCCCCCAATCTCGCACATCCTTTTTCACTTGCTCCTGCAAGATATTCACCTCCTCCTTCTGCTCTGCCAATTTCTCCTGCATACTCTGTAGTTCTGACTCTACTTCATGCTTTCTCCGTCGTAAGTTTCCAATCTCTGCTTCCTTGCGAGAAAGCTGCTCTGCATACACTATAAAAGTAGAGGAGGAACCCTTTGGAATTTCCTGACCATTGCCGATTGATTCAAGAAAAGAAATAAGGACCACTGTTGTGATCTTTGTTTCTCTTAATCTCTACAGCTCTTGCTCTTTCTCAGCTAGAACAGATAGCACCCGTTCTCTATGCTGTCGCAATTCTTCCTCCAGACGAACCATATTGTCTCTTCCTTCTCTGCGCACAGCTTCTAGCCTCCGTCGGTTGAAAATAAAGCAATAATGCAATCCTGTTTTTTGGTCTCCGTCATCTTCTGCCTTGTGTCTGTTTTGCACCTCCTTCTGAAAAAAGCGCACAAAAAAAACAAAACAATATCTTCCATTTCTATCCATCGTTTTTCCGGTCCATCCCTCCAAGTTCGCCCCCTCTAGCTCCCACCTTTTTGGTTTCCTCATATAACACTT
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCTCTTGCTTCCTGCCCACCACCTATTCCCCTCCCGTGCACGCAAAGCTGCATTTCCTTCCTCAGGATAAAAATGCAACACTGCAAGCACAGCACTCAGTGTATGCTGTCTTCCTCTGGGATCTGGCAAGGTCAAATATCCTAATAATACATTTTTCAAATACTCCATGTTTGCCCCCTCCCTCCCCCAATCTCGCACATCCTTTTTCACTTGCTCCTGCAAGATATTCACCTCCTCCTTCTGCTCTGCCAATTTCTCCTGCATACTCTGTAGTTCTGACTCTACTTCATGCTTTCTCCGTCGTAAGTTTCCAATCTCTGCTTCCTTGCGAGAAAGCTGCTCTGCATACACTATAAAAGTAGAGGAGGAACCCTTTGGAATTTCCTGACCATTGCCGATTGATTCAAGAAAAGAAATAAGGACCACTGTTGTGATCTTTGTTTCTCTTAATCTCTACAGCTCTTGCTCTTTCTCAGCTAGAACAGATAGCACCCGTTCTCTATGCTGTCGCAATTCTTCCTCCAGACGAACCATATTGTCTCTTCCTTCTCTGCGCACAGCTTCTAGCCTCCGTCGGTTGAAAATAAAGCAATAATGCAATCCTGTTTTTTGGTCTCCGTCATCTTCTGCCTTGTGTCTGTTTTGCACCTCCTTCTGAAAAAAGCGCACAAAAAAAACAAAACAATATCTTCCATTTCTATCCATCGTTTTTCCGGTCCATCCCTCCAAGTTCGCCCCCTCTAGCTCCCACCTTTTTGGTTTCCTCATATAACACTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCTCTTGCTTCCTGCCC