ORFeome > MGC154858 ORF1 – XORFeome v1.0

MGC154858 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6252187
Gene Page ID:
ORF Xenbase ID: 17257833

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123357
Original XGC clone length: 822

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ837598
dbEST ID: 79655300
Trimmed Sequence: ATGTTGTCCCTGGCCGCTCGGTCCGGTTCTGTAGCGCCTTACTTGTCGGCTACGTCATATGCCGTGGCCGGTCAGCTTAAAGCCCCTGGTGTCCGGAGCGGTGCTCCAGGCGGATAAGGTTTTGCTGGACGTGAAGAAACCTTTCCTGTGTAGAGAGTCCTTGAATGGGCAGGCTCCGAGCTGCGGCCTTTCCGCTTCGGCTGCAATTAATGGTGCCTCCTGTGTACGCTTTCTCCATAGTGATGTAACTGTACCGGACTTCTCCGATTATCGCAGACCAGAAGTCTTGGACAGTACAAAATCTTCTCAAACCAGCAGCGACTCCCGGAAAACCTTCTCGTATTTAGTCACTGGAGCTACAGCAGTGGCCTCAGCTTATGCTGCCAAAAATGCAGTTTCTCAGTTTGTCACAAGTATGAGTGCATCCGCTGATGTGCTGGCTATGTCAAAGATCAAAATAAAGTTGTCTGACATACCAAAAGGCAAGAATATGGCATTCAAATGGAGAGGAGAACCACTCTTTGTGCGTCACAGAACCGCAAAAGAAATTGATCAGGAAACCCAGGTCATGGCTCATGATCTAAGGGACCCGGGAACTGACCTTGACAAGGTGAAGAAGCCAAAGTGGGTCATGTTGGAATTGTGTGGGGGGGGGCCCTTGGCTGTTTTGGCGGGTGCCGAAGGGGGG
Full Trace Sequence: GGGCCCCAATAATAGATTTTATTCTTGACTGATAGTGACCTGNTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGTCCCTGGCCGCTCGGTCCGGTTCTGTAGCGCCTTACTTGTCGGCTACGTCATATGCCGTGGCCGGTCAGCTTAAAGCCCCTGGTGTCCGGAGCGGTGCTCCAGGCGGATAAGGTTTTGCTGGACGTGAAGAAACCTTTCCTGTGTAGAGAGTCCTTGAATGGGCAGGCTCCGAGCTGCGGCCTTTCCGCTTCGGCTGCAATTAATGGTGCCTCCTGTGTACGCTTTCTCCATAGTGATGTAACTGTACCGGACTTCTCCGATTATCGCAGACCAGAAGTCTTGGACAGTACAAAATCTTCTCAAACCAGCAGCGACTCCCGGAAAACCTTCTCGTATTTAGTCACTGGAGCTACAGCAGTGGCCTCAGCTTATGCTGCCAAAAATGCAGTTTCTCAGTTTGTCACAAGTATGAGTGCATCCGCTGATGTGCTGGCTATGTCAAAGATCAAAATAAAGTTGTCTGACATACCAAAAGGCAAGAATATGGCATTCAAATGGAGAGGAGAACCACTCTTTGTGCGTCACAGAACCGCAAAAGAAATTGATCAGGAAACCCAGGTCATGGCTCATGATCTAAGGGACCCGGGAACTGACCTTGACAAGGTGAAGAAGCCAAAGTGGGTCATGTTGGAATTGTGTGGGGGGGGGCCCTTGGCTGTTTTGGCGGGTGCCGAAGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGTCCCTGGCCGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837597
dbEST ID: 79655299
Trimmed Sequence: TCCAACAATTACTAAATCTTCAGAAGGAAACTCGTATTCCGGGACTTCAAGATTTAATGGAGCAGGACCCTTGCGAATTCTACCAGATGCATCATAATGGGATCCATGACAAGGGCAATAATAACCACCAAATTCACCAGCATTGGCAATGGGCACACAACCAAGGTGAGTGCACACACCAATCAAAATGACCCACTCTGGCTTCTTCACCCTGTCAAGGTCATGTTGTGGGTCCCTTAGATCACTGAGGCTGACCTGGGCTTCTTGATCAATTTCTTTTGCGGTTCTGTGACGCACAAAGAGTGGTTTTCCTCTCCATTTGAATGCCATATTCTTGCCTTCTGGTATGTCAGACAACTTTATTTCGATCTTTGACATAGCCAGCACATCAGCGGATGCACTCATACTTGTGACAAACTGAGAAACTGCATTTTTGGCAGCATAAGCTGAGGCCACTGCTGTAGCTCCAGTGACTAAATACGAGAAGGTTTTCCTGGAGTCGCTGCTGGTTTGAGAAGATTTTGTACTGTCCAAGACTTCTGGTCTGCGATAATCGGAGAAGTCCGGTACAGTTACATCACTATGGATAAAGCGTACACAGGGAGGACCCTTAATTGGCACCCGAAAGCGAAAAGGGCGGCACCTTCGGAGCCCGGCCCATTCAAGGAACTCCTCTACCCAAGGAAAAGGTTTCCT
Full Trace Sequence: GAGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCCAACAATTACTAAATCTTCAGAAGGAAACTCGTATTCCGGGACTTCAAGATTTAATGGAGCAGGACCCTTGCGAATTCTACCAGATGCATCATAATGGGATCCATGACAAGGGCAATAATAACCACCAAATTCACCAGCATTGGCAATGGGCACACAACCAAGGTGAGTGCACACACCAATCAAAATGACCCACTCTGGCTTCTTCACCCTGTCAAGGTCATGTTGTGGGTCCCTTAGATCACTGAGGCTGACCTGGGCTTCTTGATCAATTTCTTTTGCGGTTCTGTGACGCACAAAGAGTGGTTTTCCTCTCCATTTGAATGCCATATTCTTGCCTTCTGGTATGTCAGACAACTTTATTTCGATCTTTGACATAGCCAGCACATCAGCGGATGCACTCATACTTGTGACAAACTGAGAAACTGCATTTTTGGCAGCATAAGCTGAGGCCACTGCTGTAGCTCCAGTGACTAAATACGAGAAGGTTTTCCTGGAGTCGCTGCTGGTTTGAGAAGATTTTGTACTGTCCAAGACTTCTGGTCTGCGATAATCGGAGAAGTCCGGTACAGTTACATCACTATGGATAAAGCGTACACAGGGAGGACCCTTAATTGGCACCCGAAAGCGAAAAGGGCGGCACCTTCGGAGCCCGGCCCATTCAAGGAACTCCTCTACCCAAGGAAAAGGTTTCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCAACAATTACTAAATCTTC