ORFeome > MGC52514 ORF2 – XORFeome v1.0

MGC52514 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6251835
Gene Page ID:
ORF Xenbase ID: 17257845

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110942
Original XGC clone length: 1335

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ837683
dbEST ID: 79655385
Trimmed Sequence: ATGCCGCGCAAGGTCAGCGTGGCGGCCTGGGGGGCAGCCCTCTTTATCTCATGGAATGCTATTCTACTCCTCTACCTCATGAGCAGGTCTCGTGGCACTGATCATTCTGATCTTACTGCTCATGTTATCCAGTTGGCTGAAGAAGCAGAAGCTGAACTTGAAAAACAGAAGGGATTACTTCAACAAATACACTATTATAGTGGCCTACTTAACCATCAGCAGCCTCCTTCACATGTAAGGCCTGAACCTATAACACCTAATATGTCATTCCCTTCTCCATCTCCTGTGGGATCTGGTCCTCTCCCTTTGGTTATTCCAATACTAGTGGTGGCATGTGACCGCCCCTCTGTGAGGAGATGCCTGGATTCATTGTTAAAATACCGACCCTCGGCAGAAAATTTTCCCATTATAGTGAGCCAAGACTGTGGTCATGAGGAGACTTCAAAGATCATAGACTCCTATGGAGATGCCGTAACTCATATCANACAACCTGATCTCTCGGAGGTGGCTGTCCCACCAGAACACCGGAAGTTTCAAGGCTATTATAAAATTTCCCGCCATTACAGGTGGGCACTCAACCAGATTTTCAAAACCATGAGTTACAAAGCAGCCATTGTGGTCGAAGATGACCTGGAAGTGGCTCCCGATTTTTATGATTATTTTTAAACCACTATCTCCCTTCTGCAAAAAGACCGTATGCCATGGTGTTGTCTCAGCCCTGGATTAAAATGGCCAAGGAAACTTTTATTTATTCCTTGGGGGTATTT
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCGCGCAAGGTCAGCGTGGCGGCCTGGGGGGCAGCCCTCTTTATCTCATGGAATGCTATTCTACTCCTCTACCTCATGAGCAGGTCTCGTGGCACTGATCATTCTGATCTTACTGCTCATGTTATCCAGTTGGCTGAAGAAGCAGAAGCTGAACTTGAAAAACAGAAGGGATTACTTCAACAAATACACTATTATAGTGGCCTACTTAACCATCAGCAGCCTCCTTCACATGTAAGGCCTGAACCTATAACACCTAATATGTCATTCCCTTCTCCATCTCCTGTGGGATCTGGTCCTCTCCCTTTGGTTATTCCAATACTAGTGGTGGCATGTGACCGCCCCTCTGTGAGGAGATGCCTGGATTCATTGTTAAAATACCGACCCTCGGCAGAAAATTTTCCCATTATAGTGAGCCAAGACTGTGGTCATGAGGAGACTTCAAAGATCATAGACTCCTATGGAGATGCCGTAACTCATATCANACAACCTGATCTCTCGGAGGTGGCTGTCCCACCAGAACACCGGAAGTTTCAAGGCTATTATAAAATTTCCCGCCATTACAGGTGGGCACTCAACCAGATTTTCAAAACCATGAGTTACAAAGCAGCCATTGTGGTCGAAGATGACCTGGAAGTGGCTCCCGATTTTTATGATTATTTTTAAACCACTATCTCCCTTCTGCAAAAAGACCGTATGCCATGGTGTTGTCTCAGCCCTGGATTAAAATGGCCAAGGAAACTTTTATTTATTCCTTGGGGGTATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGCGCAAGGTCAGCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837682
dbEST ID: 79655384
Trimmed Sequence: GGTCCACGATGGGTCATAGCCTGCCCAGTCTTTGGGAGGAGCCAAGAACACCCTTCTCCCTCTGTGAGTAAAGGACACAACTCCTTTGTAAGCCGCTCTCGCCACCCCAGACTTTAAGTCCTCCATCACGCCAAAGGCCCTGGCCATAGCCTTAAAAGTGTCTTTAGTTGTATACTCCACTCTTACCGTCCTGCCCCCGGGCACTTGCCCGTGTAGCACCTCCTCTGCCCGTGCTTTGGGTGCCCCATAAACCTGCTTACGGAACCAAGGATCATAAGTATCTTTCAAAAGGTAGGAGAGGTCCATCTTAGTGAAGGCCACTGGGTCCTGATTAAGTTTGATGAATCGTAGGTGCTGATCAAAAAATTGTCCTTGGCTAACACCTTTTCTCCCAAAGGTCCGTGTGCGAGAAAGCTCTGGTCTTACACAAGCTCTACCCAACCTTTGTTCAGGACGCCTAACCCAGTCATCCCAGAATGCTGAGGGCCATTTAGGTTCAAGCTCCTCCCACAGCTCCTGGAGTAGCAACCACCCGAGTCCAGGAAAGAAATCTGAGCGGTAAAGAAGGGAACTACCCCCAAGATCAATCAAAGCTTCCTTGCCATTGTCATTCCATGCTGAGACACACCATACCATACAGTCCTTTTGCAGAAAGGAGATAGTTGTCTGAAAATACTCAGAAAAATCTGGAGCCACCTCCCCGTCATCTTCGACCACAATGGCTGCTTTGTAACCCATGGTTTTGAAAATCTTGGTGGAGGGCGGCCGGTAATGACCGGAGGTTTTGTAATAAACCTGAAAGCATCTCGTTTTCTTGGTGGTGAGGCCGACCCCCGAGAGAATAGGGTTGTTGGATTTGGGTGAACGGCACCTCCGTACGAATCTAATGATCTTTAAAGTCTCCTCCTGCACAAAAAGCATGCGCTGAGTAATAATGTTATAATTTTTGTGCCGAATGTCCGTAGGTTATGGATATGAATTCACCCCTTCCCCCCCCAAGAGCCCCCCCCCAGGTGCGGGGGGGGCCCTTTTGAAATAAAACAAGGGGGAAAGAAACAAAAAGGGCCGCGGGGGAAGGGGGGGAGAGGGGGGGGGAGGGGGAAGGGAGTGGTTTTGGTTTTTTGGTGCCCGTGACTGCTGTGAGAGGGAGAGGGGGCGGGGGAAGAGAGGAGGAGTGGGGAGGGCCAGGGGGGAAAAAAATGAAGTAATATTTTTTGGTGGTATAATATAATATTGTACTGTACTATTGGTTTTTTG
Full Trace Sequence: GGGCAGGTATCAGCTATTGAACATGTACAACGACTCACTACTAGGGGAAATCAGCTTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGTCCACGATGGGTCATAGCCTGCCCAGTCTTTGGGAGGAGCCAAGAACACCCTTCTCCCTCTGTGAGTAAAGGACACAACTCCTTTGTAAGCCGCTCTCGCCACCCCAGACTTTAAGTCCTCCATCACGCCAAAGGCCCTGGCCATAGCCTTAAAAGTGTCTTTAGTTGTATACTCCACTCTTACCGTCCTGCCCCCGGGCACTTGCCCGTGTAGCACCTCCTCTGCCCGTGCTTTGGGTGCCCCATAAACCTGCTTACGGAACCAAGGATCATAAGTATCTTTCAAAAGGTAGGAGAGGTCCATCTTAGTGAAGGCCACTGGGTCCTGATTAAGTTTGATGAATCGTAGGTGCTGATCAAAAAATTGTCCTTGGCTAACACCTTTTCTCCCAAAGGTCCGTGTGCGAGAAAGCTCTGGTCTTACACAAGCTCTACCCAACCTTTGTTCAGGACGCCTAACCCAGTCATCCCAGAATGCTGAGGGCCATTTAGGTTCAAGCTCCTCCCACAGCTCCTGGAGTAGCAACCACCCGAGTCCAGGAAAGAAATCTGAGCGGTAAAGAAGGGAACTACCCCCAAGATCAATCAAAGCTTCCTTGCCATTGTCATTCCATGCTGAGACACACCATACCATACAGTCCTTTTGCAGAAAGGAGATAGTTGTCTGAAAATACTCAGAAAAATCTGGAGCCACCTCCCCGTCATCTTCGACCACAATGGCTGCTTTGTAACCCATGGTTTTGAAAATCTTGGTGGAGGGCGGCCGGTAATGACCGGAGGTTTTGTAATAAACCTGAAAGCATCTCGTTTTCTTGGTGGTGAGGCCGACCCCCGAGAGAATAGGGTTGTTGGATTTGGGTGAACGGCACCTCCGTACGAATCTAATGATCTTTAAAGTCTCCTCCTGCACAAAAAGCATGCGCTGAGTAATAATGTTATAATTTTTGTGCCGAATGTCCGTAGGTTATGGATATGAATTCACCCCTTCCCCCCCCAAGAGCCCCCCCCCAGGTGCGGGGGGGGCCCTTTTGAAATAAAACAAGGGGGAAAGAAACAAAAAGGGCCGCGGGGGAAGGGGGGGAGAGGGGGGGGGAGGGGGAAGGGAGTGGTTTTGGTTTTTTGGTGCCCGTGACTGCTGTGAGAGGGAGAGGGGGCGGGGGAAGAGAGGAGGAGTGGGGAGGGCCAGGGGGGAAAAAAATGAAGTAATATTTTTTGGTGGTATAATATAATATTGTACTGTACTATTGGTTTTTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGTCCACGATGGGTCATA