ORFeome > MGC52585 ORF1 – XORFeome v1.0

MGC52585 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6251833
Gene Page ID:
ORF Xenbase ID: 17257863

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041187
Original XGC clone length: 1161

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11008
Well Location: G08

Sequences - 5ʹ (forward) EST

Accession: JZ823624
dbEST ID: 79641326
Trimmed Sequence: ATGTGGAAAGTGCAGGAGACTTTGGTACTGGAGGAAGAAGAGGAGGAAGAAGACGCCTCTAACAGTTGTGGGACGGGGGAAGACGAGGACGATGGGGACCCCAAGATCTGCCGTGCGTGTGGGGACCGGGCCACTGGGTATCACTTCAATGCTATGACCTGCGAGGGCTGCAAGGGATTCTTCAGGCGGGCCATGAAGAGGAACTTGCGGCTCAGTTGCCCCTTCCAGAATTCCTGCGTCATCAACAAGAGCAATCGGCGCCACTGCCAGGCCTGTCGGCTCAAGAAATGTCTGGACATCGGCATGAGGAAAGAGCTGATCATGTCCGATGCAGCGGTGGAACAGAGACGAGCGCTAATTAAGAGAAAACACAAATTAACTAAATCGCCCCCCACACCCCCAGGGGCCAGCCTGACTCCAGAGCAGCAGCACTTTCTCACTCAACTGGTTGGGGCCCACACCAAAACCTTTGACTTCAACTTCACCTTCTCCAAGAACTTTCGGCCAATAAGAAGATCTTCAGACCCAACTCAGGAGCCCCAAGCCACCTCTTCTGAAGCCTTTTTGATGCTACCTCATATATCCGACCTCGTTACCTACATGATCAAGGGCATCATCAGCTTTGCCAAAATGCTCCCCTACTTCAAGAGTCTGGACATTGAAGACCAAATTGCTCTCCTGAAAGGTTCTGTAGCGGAGGTTTCTGTGATCCGATTTCACACTGTGTTTTAACCCTGGACACATTAACGTGGGGAGTGGTGGCCCCCTTCACCTATGACCACTGGAGGGATATGTTCCCTGGGCCGGGCTTCCGGTTCAGCTGGTTTCCG
Full Trace Sequence: GCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGAAAGTGCAGGAGACTTTGGTACTGGAGGAAGAAGAGGAGGAAGAAGACGCCTCTAACAGTTGTGGGACGGGGGAAGACGAGGACGATGGGGACCCCAAGATCTGCCGTGCGTGTGGGGACCGGGCCACTGGGTATCACTTCAATGCTATGACCTGCGAGGGCTGCAAGGGATTCTTCAGGCGGGCCATGAAGAGGAACTTGCGGCTCAGTTGCCCCTTCCAGAATTCCTGCGTCATCAACAAGAGCAATCGGCGCCACTGCCAGGCCTGTCGGCTCAAGAAATGTCTGGACATCGGCATGAGGAAAGAGCTGATCATGTCCGATGCAGCGGTGGAACAGAGACGAGCGCTAATTAAGAGAAAACACAAATTAACTAAATCGCCCCCCACACCCCCAGGGGCCAGCCTGACTCCAGAGCAGCAGCACTTTCTCACTCAACTGGTTGGGGCCCACACCAAAACCTTTGACTTCAACTTCACCTTCTCCAAGAACTTTCGGCCAATAAGAAGATCTTCAGACCCAACTCAGGAGCCCCAAGCCACCTCTTCTGAAGCCTTTTTGATGCTACCTCATATATCCGACCTCGTTACCTACATGATCAAGGGCATCATCAGCTTTGCCAAAATGCTCCCCTACTTCAAGAGTCTGGACATTGAAGACCAAATTGCTCTCCTGAAAGGTTCTGTAGCGGAGGTTTCTGTGATCCGATTTCACACTGTGTTTTAACCCTGGACACATTAACGTGGGGAGTGGTGGCCCCCTTCACCTATGACCACTGGAGGGATATGTTCCCTGGGCCGGGCTTCCGGTTCAGCTGGTTTCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGAAAGTGCAGGAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ828925
dbEST ID: 79646627
Trimmed Sequence: TTCAGGGGATCCAAAGACTTCTCGCATAAGTGGGGTGGCATCAGGCTGAATGTCCCAGATCTCCAGGAGCTGCTTGCTGTGTATGTCATTGACTGTCCGAAGCTCTGTCAGACACTCCATGATCTTGGGGTACAGGAGCCTGTTCTGCAGGGAGGGGGGCCGTTGGCTGTCGATGAAATCTTTTAGTGTCAGGGCAATGTGTTCCTGCAGCTTCTGGATCTTCTCCCAGTCGCAGACCCCCGGTCGGTCAGAAGCGAAAATGGACAGAGCGGCCATCATGGCGTATTCCTCACTCTGTAGATTCAGTTTCCTCATCATGCGATGAATCCTCACCAGGGGCTCCAGGAACAGCTGACGGAAGCCGGCCAGGAACATATCCTCAGTGTCATAGGTGAAGGGGCCACACTCCCACGTATTGGTGTCAGGGTTAAACACAGTGTTGAATCGGATCACAGAAACCTCCGCTACAGAACCTTTCAGGAGAGCAATTTGGTCTTCAATGTCCAGACTCTTGAAGTAGGGGAGCATTTTGGCAAAGCTGATGATGCCCTTGATCATGTAGGTAACGAGGTCGGATATATGAGGTAGCATCAAAAAGGCTTCAGAAGAGGTGGCTTGGGGCTCCTGAGTTGGGTCTGAAGATCTTCTAATTGGCCGAAAGTCCTTGAAAAAAGGTAAAGTTAAAATCAAAAGGTTTTTGGTGTGGGGCCCCAACCAGTTTTAAATGAGAAAAGTGCTGGCTGCCCTCTGGATCCAGCGGGGCCCCCCCCG
Full Trace Sequence: ACGGGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCAGGGGATCCAAAGACTTCTCGCATAAGTGGGGTGGCATCAGGCTGAATGTCCCAGATCTCCAGGAGCTGCTTGCTGTGTATGTCATTGACTGTCCGAAGCTCTGTCAGACACTCCATGATCTTGGGGTACAGGAGCCTGTTCTGCAGGGAGGGGGGCCGTTGGCTGTCGATGAAATCTTTTAGTGTCAGGGCAATGTGTTCCTGCAGCTTCTGGATCTTCTCCCAGTCGCAGACCCCCGGTCGGTCAGAAGCGAAAATGGACAGAGCGGCCATCATGGCGTATTCCTCACTCTGTAGATTCAGTTTCCTCATCATGCGATGAATCCTCACCAGGGGCTCCAGGAACAGCTGACGGAAGCCGGCCAGGAACATATCCTCAGTGTCATAGGTGAAGGGGCCACACTCCCACGTATTGGTGTCAGGGTTAAACACAGTGTTGAATCGGATCACAGAAACCTCCGCTACAGAACCTTTCAGGAGAGCAATTTGGTCTTCAATGTCCAGACTCTTGAAGTAGGGGAGCATTTTGGCAAAGCTGATGATGCCCTTGATCATGTAGGTAACGAGGTCGGATATATGAGGTAGCATCAAAAAGGCTTCAGAAGAGGTGGCTTGGGGCTCCTGAGTTGGGTCTGAAGATCTTCTAATTGGCCGAAAGTCCTTGAAAAAAGGTAAAGTTAAAATCAAAAGGTTTTTGGTGTGGGGCCCCAACCAGTTTTAAATGAGAAAAGTGCTGGCTGCCCTCTGGATCCAGCGGGGCCCCCCCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCAGGGGATCCAAAGAC