ORFeome > MGC52881 ORF2 – XORFeome v1.0

MGC52881 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6251628
Gene Page ID:
ORF Xenbase ID: 17257959

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106632
Original XGC clone length: 1041

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: F04

Sequences - 5ʹ (forward) EST

Accession: JZ837715
dbEST ID: 79655417
Trimmed Sequence: ATGGAGAGGGAAAAGGAACAGTTCCGTAAGCTTTTTATTGGAGGCCTCAGCTTTGAAACAACAGAGGAAAGTCTGCGGAATTTCTATGAACAATGGGGGCAGCTGACGGATTGTGTGGTCATGAGAGATCCTGCGAGTAAAAGGTCCAGGGGGTTTGGCTTTGTAACCTTTTCCTGCATGAATGAAGTTGATGCAGCTATGTCTGCACGTCCACATACTATTGATGGCAGAGTAGTTGAGCCTAAGCGAGCTGTTGCCAGAGAGGAATCTGCCAAACCTGGTGCCCACGTCACTGTTAAGAAATTATTTGTTGGGGGCATTAAGGAAGACACAGAAGAGCATCATCTTCGAGAGTACTTTGAGGAATATGGGAAGATTGAGAGCACTGAAATCATTACAGACAAACAGTCTGGAAAGAAAAGGGGATTTGGCTTTGTGACTTTTAATGACCATGACCCACTTGATAAGATAGTTTTGCAAAAGTATCACACAATAAATGGGCACAATGCAGAAGTAAGAAAAGCCTTATCCGAACAAGAAATGCAAGATGTTCAGAACACCCGAAATAACAGAGGAGGTAATTTCGGCTTTGGAGAACTCAGAAGTGGTGGGTAACTTTGGTTCAAGACCGGGAGGCAACTTCAAAAGAGGATCTGAAGGTTATGGAAGGTGGGGGGGGGTATGGCGGGGGTATTAAGGTATATAGTGGTGGTGAGGGGGGTGGCCACCTGTTGTAGTTTAAACCCACCGTT
Full Trace Sequence: TCGGGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGAGGGAAAAGGAACAGTTCCGTAAGCTTTTTATTGGAGGCCTCAGCTTTGAAACAACAGAGGAAAGTCTGCGGAATTTCTATGAACAATGGGGGCAGCTGACGGATTGTGTGGTCATGAGAGATCCTGCGAGTAAAAGGTCCAGGGGGTTTGGCTTTGTAACCTTTTCCTGCATGAATGAAGTTGATGCAGCTATGTCTGCACGTCCACATACTATTGATGGCAGAGTAGTTGAGCCTAAGCGAGCTGTTGCCAGAGAGGAATCTGCCAAACCTGGTGCCCACGTCACTGTTAAGAAATTATTTGTTGGGGGCATTAAGGAAGACACAGAAGAGCATCATCTTCGAGAGTACTTTGAGGAATATGGGAAGATTGAGAGCACTGAAATCATTACAGACAAACAGTCTGGAAAGAAAAGGGGATTTGGCTTTGTGACTTTTAATGACCATGACCCACTTGATAAGATAGTTTTGCAAAAGTATCACACAATAAATGGGCACAATGCAGAAGTAAGAAAAGCCTTATCCGAACAAGAAATGCAAGATGTTCAGAACACCCGAAATAACAGAGGAGGTAATTTCGGCTTTGGAGAACTCAGAAGTGGTGGGTAACTTTGGTTCAAGACCGGGAGGCAACTTCAAAAGAGGATCTGAAGGTTATGGAAGGTGGGGGGGGGTATGGCGGGGGTATTAAGGTATATAGTGGTGGTGAGGGGGGTGGCCACCTGTTGTAGTTTAAACCCACCGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGAGGGAAAAGGAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837714
dbEST ID: 79655416
Trimmed Sequence: ATAACGATTTCTTCCTCCATATCCTCCACCACCACTTGCTCCACTACCATTTCCAGGACCATAGTTTCCTCCGCCATATGGCCCGCCCATACTCCTGTTTCCACCGAAATTTCCACCACTCTTCATTGGTCCATAACTGGAAGACTGTTGATTATAGTTCCCAAAGTCATTGTAGTTTCCACCTCCACCATAGTTTCCTCCACCATAGTTGTCATAGCCGCCTCCATATCCGCCTCCTTGGTTGCCATAGCTAGGGCCACCTCCATAACCCCCTCTTCCTCCTCCTGCTCCATAGCTGGGTCCACCTCCAAAGTTGCCACCGCCTTGACCACCACCATATCCATTATAGCCATCGCCATAACCGCGCCCACCTCCATAACCATCAGATCCTCCTCTGAAGTTGCCTCCCGGTCCTGAACCAAAGTTACCACCACCTCTTGAGTCTCCAAAGCCGAAATTACCTCCTCTGTTATTTCGGGTGTTCTGAACATCTTGCATTTCTTGTTTGGATAAGGCTTTTCTTACTTCTGCATTGTGCCCATTTATTGTGTGATACTTTTGCAAAACTATCTTATCAACTGGGTCATGGTCATTAAAAGTCACAAAGCCAAATCCCCTTTTCTTTCCAGACTGTTTGTCTGTAATGATTTCAGTGCTCTCAATCTTCCCATATTCCTCAAAGTACTCTCGAAGATGATGCTCTTCTGTGTCTTCCTTAATGCCCCCCACAAATAATTTCTTAACAGTGACGTGGGCACCGGGTTTGGCAGATTCCTCTCTGGCAACAGCTCCCTTAAGCTCAACTACTCCTGCCCTCATAGTATGTGGGACGTGGAGACATACCTCATCCACTTTATTCATGCAGGAAAAAGGTACAAAACAAAAACCCCCTGCACCTTTTATCCACAGAACCCTCAGGAACACACAAACCATCACCTCCCCCCCTTGCTCATAAAAATCCCCCAAAATTTTCTTCTTTGTTTTAAGGCTGAGAGCCCTCAAAAAAAAAGCCTAAAAGAACAAGTCCTTTTTTCCTTCTCCCTCGGCCCCCCACCTTTTTTTGTTTTAGGGTTGGTTTTTTTGAGGAAGGAACGGGGGTTGTTCCTCACATTTTTGGTGTGGGAGGAAAAAAAAAGAAAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATATATAAATTAAAAAAGTACCTACCAAAC
Full Trace Sequence: GGTCAGGGAAACAGCTTATGAACCATGTAATACGACTCACTACTAGGGGAAACCAGCTTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATAACGATTTCTTCCTCCATATCCTCCACCACCACTTGCTCCACTACCATTTCCAGGACCATAGTTTCCTCCGCCATATGGCCCGCCCATACTCCTGTTTCCACCGAAATTTCCACCACTCTTCATTGGTCCATAACTGGAAGACTGTTGATTATAGTTCCCAAAGTCATTGTAGTTTCCACCTCCACCATAGTTTCCTCCACCATAGTTGTCATAGCCGCCTCCATATCCGCCTCCTTGGTTGCCATAGCTAGGGCCACCTCCATAACCCCCTCTTCCTCCTCCTGCTCCATAGCTGGGTCCACCTCCAAAGTTGCCACCGCCTTGACCACCACCATATCCATTATAGCCATCGCCATAACCGCGCCCACCTCCATAACCATCAGATCCTCCTCTGAAGTTGCCTCCCGGTCCTGAACCAAAGTTACCACCACCTCTTGAGTCTCCAAAGCCGAAATTACCTCCTCTGTTATTTCGGGTGTTCTGAACATCTTGCATTTCTTGTTTGGATAAGGCTTTTCTTACTTCTGCATTGTGCCCATTTATTGTGTGATACTTTTGCAAAACTATCTTATCAACTGGGTCATGGTCATTAAAAGTCACAAAGCCAAATCCCCTTTTCTTTCCAGACTGTTTGTCTGTAATGATTTCAGTGCTCTCAATCTTCCCATATTCCTCAAAGTACTCTCGAAGATGATGCTCTTCTGTGTCTTCCTTAATGCCCCCCACAAATAATTTCTTAACAGTGACGTGGGCACCGGGTTTGGCAGATTCCTCTCTGGCAACAGCTCCCTTAAGCTCAACTACTCCTGCCCTCATAGTATGTGGGACGTGGAGACATACCTCATCCACTTTATTCATGCAGGAAAAAGGTACAAAACAAAAACCCCCTGCACCTTTTATCCACAGAACCCTCAGGAACACACAAACCATCACCTCCCCCCCTTGCTCATAAAAATCCCCCAAAATTTTCTTCTTTGTTTTAAGGCTGAGAGCCCTCAAAAAAAAAGCCTAAAAGAACAAGTCCTTTTTTCCTTCTCCCTCGGCCCCCCACCTTTTTTTGTTTTAGGGTTGGTTTTTTTGAGGAAGGAACGGGGGTTGTTCCTCACATTTTTGGTGTGGGAGGAAAAAAAAAGAAAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATATATAAATTAAAAAAGTACCTACCAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAACGATTTCTTCCTCCATATCC