ORFeome > MGC52894 ORF1 – XORFeome v1.0

MGC52894 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256053
Gene Page ID:
ORF Xenbase ID: 17257965

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045212
Original XGC clone length: 1788

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ823858
dbEST ID: 79641560
Trimmed Sequence: ATGGAGCGGTCAGCAGCTTTCTTCCTTTGCTTCCTGGCAGCCATCGCTGTCTCCTCCAGGGCGCTGGACTTGGTGAATGAGGATGTCAAGCGCACAGTGGACCTCAGCAGCCATTTAGCCAAAGTGACGGCGGAGATTACTATTTCTAACCCGGGACCGGGCGCCGTTCATTCCTTTCTGTTGGCCCTGGAGTCAGAGCTGAGCAGCCATTTGGCCTACCTAGGGGTGAAAGGGGAGGATGAAGAAGATGGAACCCTTCAGGTACAAGAAACAAACGTAAAAGGCAAAAGTGGATTACAATACACAGTGCATTTTGGATCCTCTCTTGCCCCTGGAGCTAAAACCAAAGTTATCGTCGAGACAGTCTTTACACATGTGCTTCAGCCATATCCCACCCAGATCACACAGGCTGAGAAACAGTTTGTCACATTTGAAGGCAACCATTATTTCTTTTCACCTTACCCAACCAAGTCCCAGACCACACGCGTCAAGCTCGCCTCTAAAAATGTTGAGACATATACCAAGCTCGGAAACCCTACCAGATCTGAGGAACTCATAGAATACGGTCCATTTAAGGATATTGCACCTTGGAGCCAGGACCCCTTAAAAGTTCACTATGAGAACAACAGCCCATTCCTAACAATTACTAGCATGACACGCCTGATTGAGGTCTCTCACTGGGGTAACATTGCTGTGGAAGAGACGGTTGACTTGAAACACACCGGCGCATATCTTGAAGGACCCTTCTCAAAATATGATTACCAGCGGCCGGCCAGAACGGGGGCAATTTTCATCCA
Full Trace Sequence: ATTGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCGGTCAGCAGCTTTCTTCCTTTGCTTCCTGGCAGCCATCGCTGTCTCCTCCAGGGCGCTGGACTTGGTGAATGAGGATGTCAAGCGCACAGTGGACCTCAGCAGCCATTTAGCCAAAGTGACGGCGGAGATTACTATTTCTAACCCGGGACCGGGCGCCGTTCATTCCTTTCTGTTGGCCCTGGAGTCAGAGCTGAGCAGCCATTTGGCCTACCTAGGGGTGAAAGGGGAGGATGAAGAAGATGGAACCCTTCAGGTACAAGAAACAAACGTAAAAGGCAAAAGTGGATTACAATACACAGTGCATTTTGGATCCTCTCTTGCCCCTGGAGCTAAAACCAAAGTTATCGTCGAGACAGTCTTTACACATGTGCTTCAGCCATATCCCACCCAGATCACACAGGCTGAGAAACAGTTTGTCACATTTGAAGGCAACCATTATTTCTTTTCACCTTACCCAACCAAGTCCCAGACCACACGCGTCAAGCTCGCCTCTAAAAATGTTGAGACATATACCAAGCTCGGAAACCCTACCAGATCTGAGGAACTCATAGAATACGGTCCATTTAAGGATATTGCACCTTGGAGCCAGGACCCCTTAAAAGTTCACTATGAGAACAACAGCCCATTCCTAACAATTACTAGCATGACACGCCTGATTGAGGTCTCTCACTGGGGTAACATTGCTGTGGAAGAGACGGTTGACTTGAAACACACCGGCGCATATCTTGAAGGACCCTTCTCAAAATATGATTACCAGCGGCCGGCCAGAACGGGGGCAATTTTCATCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCGGTCAGCAGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ829166
dbEST ID: 79646868
Trimmed Sequence: CAAGCCAACAAGAATGTTGTCTATTTTGTTGACGAGCTCCTGCCTCCTGTTTGAGTGCTGCTTCTCGTTCTCAATGTAACTTTCCTTTTTTAGTTTCCCAGAAACGAGACGTTCAGCTTCAGAGGAGCATTTCAAAACAATCTCCTTCACTTGGGTATCCAGCTTCTGAATTTCTGCAACTTTATCACACAAATCAGAGCCTTCAGCTTTAAGTTTGGACTGTAGCGAAGCAATTTCATTGGTCAGATTCTTGTGTTCAGTCTCCAGTGTTTTCTTGCCACTGTTTAAGGAGGATATATCCCGGGACAGCTTATACTTGTTAACAGCCTCATCAAAGTGACGGTACAGCCCAAGTCTCTTGTTTACCAGTGTAAGAATCTGTTCAGTGATGCAGGCAGCTTTCATCTTGGCCTCTGCAGCTGGATCCTTAGTGATGGAGAAATCCAGTCGCACATAGAGAATGACAGTGAAGAACAATATGTAGAATGCTGCCACAACTAGCAGTGGTTCCTGCAGCATTAATATATTGTTAAAGGAGTAATGTACCACAATGTCCTGTATATGCTGCTCAACCAGATTGTTCTTATGAGCTACAATGACTGCTCTGCCAAATGTGTCCAGATAAGTGTAGTGCAGCTCATCAGGAGCACGGTTTAGGTCATANGGGGTATTCCAAATGGATGTTTTTTGGCACCTTCTGGGCAGGATTAATTTTAACAGTTAACCGAATCCACCAACTTGGGTCATTAAAACACTTGAATCAAAATAAGGCCCCCC
Full Trace Sequence: TCGACAGGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAGCCAACAAGAATGTTGTCTATTTTGTTGACGAGCTCCTGCCTCCTGTTTGAGTGCTGCTTCTCGTTCTCAATGTAACTTTCCTTTTTTAGTTTCCCAGAAACGAGACGTTCAGCTTCAGAGGAGCATTTCAAAACAATCTCCTTCACTTGGGTATCCAGCTTCTGAATTTCTGCAACTTTATCACACAAATCAGAGCCTTCAGCTTTAAGTTTGGACTGTAGCGAAGCAATTTCATTGGTCAGATTCTTGTGTTCAGTCTCCAGTGTTTTCTTGCCACTGTTTAAGGAGGATATATCCCGGGACAGCTTATACTTGTTAACAGCCTCATCAAAGTGACGGTACAGCCCAAGTCTCTTGTTTACCAGTGTAAGAATCTGTTCAGTGATGCAGGCAGCTTTCATCTTGGCCTCTGCAGCTGGATCCTTAGTGATGGAGAAATCCAGTCGCACATAGAGAATGACAGTGAAGAACAATATGTAGAATGCTGCCACAACTAGCAGTGGTTCCTGCAGCATTAATATATTGTTAAAGGAGTAATGTACCACAATGTCCTGTATATGCTGCTCAACCAGATTGTTCTTATGAGCTACAATGACTGCTCTGCCAAATGTGTCCAGATAAGTGTAGTGCAGCTCATCAGGAGCACGGTTTAGGTCATANGGGGTATTCCAAATGGATGTTTTTTGGCACCTTCTGGGCAGGATTAATTTTAACAGTTAACCGAATCCACCAACTTGGGTCATTAAAACACTTGAATCAAAATAAGGCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAGCCAACAAGAATGTTGTCTA