ORFeome > MGC52924 ORF2 – XORFeome v1.0

MGC52924 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256077
Gene Page ID:
ORF Xenbase ID: 17257995

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108783
Original XGC clone length: 465

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: B05

Sequences - 5ʹ (forward) EST

Accession: JZ837646
dbEST ID: 79655348
Trimmed Sequence: ATGAAGACTTTGCCTTATTTCTGCCGGGGCGAGGTGGTCAAGGGTTTCGGCAGAGGCTCCAAGGAGCTGGGCATCCCCACAGCTAACTTTGCTGAAAAAATTGTGGACAGGCTTCCTGCTGACATATCTACTGGCATTTATTATGGTTGGGGCCAAGTGGGAAATGGTGAAGTTTACAAAATGGTCATGAGTATTGGCTGGAATCCTTTCTACAAAAACACCAAGAAATCTATGGAAACACATATAATTCATGATTTTCATGAGGACTTCTACGGAGAAATTCTCAGTATAGTCATTGCCGGCTACATTAGACCAGAAAAAAGTTTTACTTCCCTTGATGCTTTAATTTCTGCAATCCACAGTGACATCGAGGAGGCCAAAAAAAGACTAGAACTACCAGAATTCCAAGCACTTAGAGACCGTTTCTTTTGCAGCCCATCACATACAATAATGAACGGTCATTT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGACTTTGCCTTATTTCTGCCGGGGCGAGGTGGTCAAGGGTTTCGGCAGAGGCTCCAAGGAGCTGGGCATCCCCACAGCTAACTTTGCTGAAAAAATTGTGGACAGGCTTCCTGCTGACATATCTACTGGCATTTATTATGGTTGGGGCCAAGTGGGAAATGGTGAAGTTTACAAAATGGTCATGAGTATTGGCTGGAATCCTTTCTACAAAAACACCAAGAAATCTATGGAAACACATATAATTCATGATTTTCATGAGGACTTCTACGGAGAAATTCTCAGTATAGTCATTGCCGGCTACATTAGACCAGAAAAAAGTTTTACTTCCCTTGATGCTTTAATTTCTGCAATCCACAGTGACATCGAGGAGGCCAAAAAAAGACTAGAACTACCAGAATTCCAAGCACTTAGAGACCGTTTCTTTTGCAGCCCATCACATACAATAATGAACGGTCATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCCTGAAAAATAAAAAAAAAAAACAAAAATCCCAGAATGTTACACGCCNNCNCNTGNGNGNNGGNGNNNGNNNNCCCCCCCCCTTCCCCCTCCCCGGGGGGGGGGCCTCTTTTTTTTTTGTTGGTCCGGGTAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGACTTTGCCTTATTTCTGC

Sequences - 3ʹ (reverse) EST

Accession: JZ837645
dbEST ID: 79655347
Trimmed Sequence: ATGACCGTTCATTATTGTATGTGATGGGCTGCAAAAGAAACGGTCTCTAAGTGCTTGGAATTCTGGTAGTTCTAGTCTTTTTTTGGCCTCCTCGATGTCACTGTGGATTGCAGAAATTAAAGCATCAAGGGAAGTAAAACTTTTTTCTGGTCTAATGTAGCCGGCAATGACTATACTGAGAATTTCTCCGTAGAAGTCCTCATGAAAATCATGAATTATATGTGTTTCCATAGATTTCTTGGTGTTTTTGTAGAAAGGATTCCAGCCAATACTCATGACCATTTTGTAAACTTCACCATTTCCCACTTGGCCCCAACCATAATAAATGCCAGTAGATATGTCAGCAGGAAGCCTGTCCACAATTTTTTCAGCAAAGTTAGCTGTGGGGATGCCCAGCTCCTTGGAGCCTCTGCCGAAACCCTTGACCACCTCGCCCCGGCAGAAATAAGGCAAAGTCTTCATGG
Full Trace Sequence: GGCGACTGCAGGGAACAGCTATGACCATGTAATACGACTCACTACTAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGACCGTTCATTATTGTATGTGATGGGCTGCAAAAGAAACGGTCTCTAAGTGCTTGGAATTCTGGTAGTTCTAGTCTTTTTTTGGCCTCCTCGATGTCACTGTGGATTGCAGAAATTAAAGCATCAAGGGAAGTAAAACTTTTTTCTGGTCTAATGTAGCCGGCAATGACTATACTGAGAATTTCTCCGTAGAAGTCCTCATGAAAATCATGAATTATATGTGTTTCCATAGATTTCTTGGTGTTTTTGTAGAAAGGATTCCAGCCAATACTCATGACCATTTTGTAAACTTCACCATTTCCCACTTGGCCCCAACCATAATAAATGCCAGTAGATATGTCAGCAGGAAGCCTGTCCACAATTTTTTCAGCAAAGTTAGCTGTGGGGATGCCCAGCTCCTTGGAGCCTCTGCCGAAACCCTTGACCACCTCGCCCCGGCAGAAATAAGGCAAAGTCTTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAGACTAAAAAAACAAAAAAAACAAAATTGACTGGGAGTTCGACAAAGGGCCCGGAACAAAAAACAAAAGCGTCCAGTGGAAAAAAGGGCTCTTTTTTTAAAAACTTTTGTTCGGGAACCCCCCACACAAAGGAAAAAACCGGTGGGGGTTATAAATATAGTAAACAGGGGCGGGCACAACCGACGCCCAAAAAATGGGAGAAGAGGGAGGGGAAGGGAGGGGGGGGGGTAAGAGGGTTAGTAGATTTTATTGAGGAGAGGAAGCAAGCCGCCGACAGACGGAGAGGAGTAAAAGAGGGGGAAGAAAAGGGAGAGAGAAGAAAAGNGAGAAGGAGAGGNAAAAAGGAAAGAAAAGAGAAAGAAAAAGAGGAAAGAAGAAGGATGAAGAGAAAAGAGAAGAGAGGAAGAAGGGGAGCAGGAGAGAAGAAGAGAGGACAGAGGAAACAGCGGGAAGGGGAGGAATAGGAAGAAAGAAGAGAGGGGANGGCGAAAGGGAAGGGCGGGGAGAGAAGGGGAGAGGCGGGAAGGGAAAGAGGNAAGAGGGGCGAGAAAACGGGAGGGAGGGANATATGAGNNAGGGAAAGAGNGGGANGGAGAANGAAGAAGAGAACAGGCGGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGACCGTTCATTATTGTATGTGA