ORFeome > MGC52924 ORF3 – XORFeome v1.0

MGC52924 ORF3 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6253623
Gene Page ID:
ORF Xenbase ID: 17258001

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108796
Original XGC clone length: 375

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: B12

Sequences - 5ʹ (forward) EST

Accession: JZ837750
dbEST ID: 79655452
Trimmed Sequence: ATGAATGGTTCAAATATTGGGAACAACACATCTAATGCCAAATCAAACAGCGACCACGTTGTAAATGGGCATGGTGAAAATGAAAACAACCCCTTTGCTGAATATATGTGGATGGAGAATGAAGAAGACTTCAACAGACAGGTGGAGGAGGAGCTGCAGGAACAGGATTTTCTAGATCGCTGCTTCCAGGAGATGTTGGATGAAGAGGACAAGGATTGGTTCATTCCATCCCGTGACTTGCCGCAGGGTGTGGGCCAATTGCAGCAGCAGTTAAATGGGCTCACAGTCAATGAAAATCACAGTACAGAGGAAATAGTGAGCAAAAGCAACCTGAACCCCGATGCCAAGGAATTTGTTCCGGGAGTGAAGTACTT
Full Trace Sequence: TCGAGGGCCATATAAGTGATTTTANTTTTGACTGATAGTGACCTNGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATGGTTCAAATATTGGGAACAACACATCTAATGCCAAATCAAACAGCGACCACGTTGTAAATGGGCATGGTGAAAATGAAAACAACCCCTTTGCTGAATATATGTGGATGGAGAATGAAGAAGACTTCAACAGACAGGTGGAGGAGGAGCTGCAGGAACAGGATTTTCTAGATCGCTGCTTCCAGGAGATGTTGGATGAAGAGGACAAGGATTGGTTCATTCCATCCCGTGACTTGCCGCAGGGTGTGGGCCAATTGCAGCAGCAGTTAAATGGGCTCACAGTCAATGAAAATCACAGTACAGAGGAAATAGTGAGCAAAAGCAACCTGAACCCCGATGCCAAGGAATTTGTTCCGGGAGTGAAGTACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCATTCAAAATAAAATCATTATTTGCCATCCAGCTAATATCCCCTATAGTGATTCGTATTACATGGTCATAGCTGTTTCCTGGCAAAAAAAACCAAAAAATACAAATTTTATATGGTACATGAAAACACCCGGGAGGAAAAAAAAAAATTCCTGTTTGCCCAAGTGGGGGTTGTTTAAAATGTTGTTATTGGGAAAAAAAAGAAAACAAAGGAAAAAAGAAGGGGGGAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATGGTTCAAATATTGGGAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837749
dbEST ID: 79655451
Trimmed Sequence: GTACTTCACTCCCGGAACAAATTCCTTGGCATCGGGGTTCAGGTTGCTTTTGCTCACTATTTCCTCTGTACTGTGATTTTCATTGACTGTGAGCCCATTTAACTGCTGCTGCAATTGGCCCACACCCTGCGGCAAGTCACGGGATGGAATGAACCAATCCTTGTCCTCTTCATCCAACATCTCCTGGAAGCAGCGATCTAAAAAATCCTGTTCCTGCAGCTCCTCCTCCACCTGTCTGTTGAAGTCTTCTTCATTCTCCATCCACATATATTCAGCAAAGGGGTTGTTTTCATTTTCACCATGCCCATTTACAACGTGGTCGCTGTTTGATTTGGCATTAAATGTGTTGTTCCCAATATTTGAACCATTCATGG
Full Trace Sequence: GGGCGGGCATCAGCTTATGACCATGTAATACGACTCACTATTAGGGGAGATCAGCTTGGATGGCAAAAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTACTTCACTCCCGGAACAAATTCCTTGGCATCGGGGTTCAGGTTGCTTTTGCTCACTATTTCCTCTGTACTGTGATTTTCATTGACTGTGAGCCCATTTAACTGCTGCTGCAATTGGCCCACACCCTGCGGCAAGTCACGGGATGGAATGAACCAATCCTTGTCCTCTTCATCCAACATCTCCTGGAAGCAGCGATCTAAAAAATCCTGTTCCTGCAGCTCCTCCTCCACCTGTCTGTTGAAGTCTTCTTCATTCTCCATCCACATATATTCAGCAAAGGGGTTGTTTTCATTTTCACCATGCCCATTTACAACGTGGTCGCTGTTTGATTTGGCATTAAATGTGTTGTTCCCAATATTTGAACCATTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACAAACAGGTCACTATCATTCAAAATAAAATCATTATTTGGGGCCCAACCTTAAAACAAACCGTCAAAATAAAACGTCACTGCTGGCTGAGAACTGCCCGGGGAAAATGAATCGAAAGGCAGTTTGCAAAAGGGGCGGGGGGGTTTACCTGTGGGGGGGGATAGAAGGGGAAACCGCAAGGACAAAAGCCTCGAGAAGTCGAAAGGGGTGGGGGGGAAGGGGGCGCCCCCTCCTTGGGCGGAGCTTGTGCAAAAAACCCGGGGGAGGGGGAAGGGGAGTTAGGGGGGGGGGGGGGGTGGGTTTGTGGGGGACTCGGGGGCCGGGGGGGGGAAGAAAGAGGAGGGGGGGGGGGGGGGGGCGGGTGAGGGTGAGAAGAAAAACAGAAAAAGAAGAGGGGGTGTCGCGAGGAGAGGATGTGGGCGTGGGGGGAGGGGGGAGGGGGGAGAGGGTGGGAGGCGAAGAGAAGGAGAGGGGGGCGAGGAAGCGACAACGACGGTGAGGGGGGGGGGGGGTAGGGGAGACGGGACAGAGGAGAGGGGAGGAGAAAACAAAGAAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTACTTCACTCCCGGAACA