ORFeome > MGC52968 ORF1 – XORFeome v1.0

MGC52968 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256088
Gene Page ID:
ORF Xenbase ID: 17258019

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046664
Original XGC clone length: 771

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: F08

Sequences - 5ʹ (forward) EST

Accession: JZ823926
dbEST ID: 79641628
Trimmed Sequence: ATGGGCACCGATGTGTGGGTTGGAACCTGGAGACCCCACAGACCACGGGGTCCCATTGCAGCTCTCTACAGCAGCCCAGGACCCAAGTATTCACTACCAGGAAATACAGGTTTTGTCAATCATGATTCCAGTCGACATCGTGCTCCGGCTTATAGTATGGGGAATCGCAGTTTTAAGTTTGTTGATGACTGTTCACCAGGACCAGGATATCTGGTGCCATATAATATCACTGTAAAGGGAAAGGATGGAACCCCTGCTTATTCCATCTATGGCAGACCAAAAGACATCTCCTCCTTTAGGACCCCAGGACCAGGTAGTTATTCTCCAGAGCGTGCTGGGAGATCTGCATACCACTCAGCTCCAGTATACTCACTTGGTGAAAGAACAAAGACATTCAGCAATGACCAAACACCAGGTCCAGCAGCATATGTGCTCCCCTCTGTAATTGGGCCAAGGATAGTGAACCGATCTTCTGCCCCAAACTACTCTATGACAGGACGGAGCAAAATCGGTAGCTTTCATGAAGACCTGCAGAAAACACCTGGTCCTGGGACATATCGTGTTGTAGATCCTGCTACATATAAACACAGACTTCCTCAATACAGCATGACTGCCCGAAATGTATTGCCTGGTGATACTACAAGAAAACCTGGCCCANGAGCCTACAGCCCAGAAAAGGTGTTCATGTNCAGGGCTCANGCTCCTAACTTCTCTTTTGGTATCGGCACTCAGATTACGTGCTCCCTTGATCGTGAATGTAGCAGACTGGCCACTTTTCTGTTCAAAGTTGGCATTATAAAAAAAGCTTGGCTTTTAAATTTGTTGGCA
Full Trace Sequence: CAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGCACCGATGTGTGGGTTGGAACCTGGAGACCCCACAGACCACGGGGTCCCATTGCAGCTCTCTACAGCAGCCCAGGACCCAAGTATTCACTACCAGGAAATACAGGTTTTGTCAATCATGATTCCAGTCGACATCGTGCTCCGGCTTATAGTATGGGGAATCGCAGTTTTAAGTTTGTTGATGACTGTTCACCAGGACCAGGATATCTGGTGCCATATAATATCACTGTAAAGGGAAAGGATGGAACCCCTGCTTATTCCATCTATGGCAGACCAAAAGACATCTCCTCCTTTAGGACCCCAGGACCAGGTAGTTATTCTCCAGAGCGTGCTGGGAGATCTGCATACCACTCAGCTCCAGTATACTCACTTGGTGAAAGAACAAAGACATTCAGCAATGACCAAACACCAGGTCCAGCAGCATATGTGCTCCCCTCTGTAATTGGGCCAAGGATAGTGAACCGATCTTCTGCCCCAAACTACTCTATGACAGGACGGAGCAAAATCGGTAGCTTTCATGAAGACCTGCAGAAAACACCTGGTCCTGGGACATATCGTGTTGTAGATCCTGCTACATATAAACACAGACTTCCTCAATACAGCATGACTGCCCGAAATGTATTGCCTGGTGATACTACAAGAAAACCTGGCCCANGAGCCTACAGCCCAGAAAAGGTGTTCATGTNCAGGGCTCANGCTCCTAACTTCTCTTTTGGTATCGGCACTCAGATTACGTGCTCCCTTGATCGTGAATGTAGCAGACTGGCCACTTTTCTGTTCAAAGTTGGCATTATAAAAAAAGCTTGGCTTTTAAATTTGTTGGCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCACCGATGTGTGGGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ829235
dbEST ID: 79646937
Trimmed Sequence: GTCTGCTACATCCACGATCAGGGGAGCAACGTAATCTGAGTGCCGAATACCAAAAGAGAAGTTAGGAGCCTGAGGCCTTGACATGAACACCTTTTCTGGGCTGTAGGCTCCTGGGCCAGGTTTTCTTGTAGTATCACCAGGCAATACATTTCGGGCAGTCATGCTGTATTGAGGAAGTCTGTGTTTATATGTAGCAGGATCTACAACACGATATGTCCCAGGACCAGGTGTTTTCTGCAGGTCTTCATGAAAGCTACCGATTTTGCTCCGTCCTGTCATAGAGTAGTTTGGGGCAGAAGATCGGTTCACTATCCTTGGCCCAATTACAGAGGGGAGCACATATGCTGCTGGACCTGGTGTTTGGTCATTGCTGAATGTCTTTGTTCTTTCACCAAGTGAGTATACTGGAGCTGAGTGGTATGCAGATCTCCCAGCACGCTCTGGAGAATAACTACCTGGTCCTGGGGTCCTAAAGGAGGAGATGTCTTTTGGTCTGCCATAGATGGAATAAACAGGGGTTCCATCCCTTCCCTTTACAGTGATATTATATGGCACCAGATATCCGGGTCCTGGTGAACAGTCATCAACAAACTTAAAAATGCGAATTCCCCAACTAATAGCCGGAACAAGAAGTTCAAGGGAATCAGGATTGGACAAACCCGGTATTTCCCGGGTATGAAATACTTGGGTTCCGGGGCTGGCTGGAAAAAAACCT
Full Trace Sequence: CCGCACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCTGCTACATCCACGATCAGGGGAGCAACGTAATCTGAGTGCCGAATACCAAAAGAGAAGTTAGGAGCCTGAGGCCTTGACATGAACACCTTTTCTGGGCTGTAGGCTCCTGGGCCAGGTTTTCTTGTAGTATCACCAGGCAATACATTTCGGGCAGTCATGCTGTATTGAGGAAGTCTGTGTTTATATGTAGCAGGATCTACAACACGATATGTCCCAGGACCAGGTGTTTTCTGCAGGTCTTCATGAAAGCTACCGATTTTGCTCCGTCCTGTCATAGAGTAGTTTGGGGCAGAAGATCGGTTCACTATCCTTGGCCCAATTACAGAGGGGAGCACATATGCTGCTGGACCTGGTGTTTGGTCATTGCTGAATGTCTTTGTTCTTTCACCAAGTGAGTATACTGGAGCTGAGTGGTATGCAGATCTCCCAGCACGCTCTGGAGAATAACTACCTGGTCCTGGGGTCCTAAAGGAGGAGATGTCTTTTGGTCTGCCATAGATGGAATAAACAGGGGTTCCATCCCTTCCCTTTACAGTGATATTATATGGCACCAGATATCCGGGTCCTGGTGAACAGTCATCAACAAACTTAAAAATGCGAATTCCCCAACTAATAGCCGGAACAAGAAGTTCAAGGGAATCAGGATTGGACAAACCCGGTATTTCCCGGGTATGAAATACTTGGGTTCCGGGGCTGGCTGGAAAAAAACCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTGCTACATCCACGAT