ORFeome > MGC53078 ORF1 – XORFeome v1.0

MGC53078 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5910111
Gene Page ID: 5910088
ORF Xenbase ID: 17258055

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC043800
Original XGC clone length: 795

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11012
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ824034
dbEST ID: 79641736
Trimmed Sequence: ATGACCCAGGATGATGATGATGATGATGATGATGATGACGACGAGGAGGAAGGTGAAAACTTTGGTTATCCCTTCGCTCGGCCTCCTGGTTCCCACTTTGGATTCTCATTTGGACCGGGCCGTGACCCGATGGCCAATGTCTTTGGTTTCGAGGAATTCTTCAGGGATTTCAATGAACTTTTTGCAGATTTCGGATCAATAACGCAAGTGGTTCCCGAGCTGCCAGGAGTGGATCCCCCATTGCAGAGGCCAGAGGTTCCTAGAGGAAAGTCACTTCGGGACTTCATGCTGAAATCCCCAGACTCGCACCTCCCAAGGGATCAGCCCCCACAATCCCAAAGCCCCAGCTCCCAGGCCCCTCCCAGACTTCCAAGGACAACACCGTGGGGCAGATACAGATGGGATGATGGGGAGGTTGGAATCTCACAAGGGGACACCAAGCAAGACCGAGATCTGGATTCAGAAGTCTCTTCTCGGGGTTTGGACACAATTCTGAGACCGGCAGAGCCGAGATCCTCCTCCTTTTTCCAGAGTGTTTCTGTGTCGAAGATTGTCAGACCCGATGGGACGATAGAGGAGAGACGCACTGTACGTGACGGCCAAGGGAACTCGAGCACCACAGTGACAGTGCAGAGAGGGGACGAGATCCTCAGCAGTGAGACTCAAGACGGCCCCCAGGCGCCAATCATTGGGGATCACATACACAGACCCCTCGGATCATTACTCCCCTCCCGAACTGTCCCAACTCCTCCGACTTTTACTCAGCAGGATCCTCCCCGAAAAGGGGTCCTTCCCGGCGA
Full Trace Sequence: TATTGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCGACTTTGTACAAAAAAGTTGGCACCATGACCCAGGATGATGATGATGATGATGATGATGATGACGACGAGGAGGAAGGTGAAAACTTTGGTTATCCCTTCGCTCGGCCTCCTGGTTCCCACTTTGGATTCTCATTTGGACCGGGCCGTGACCCGATGGCCAATGTCTTTGGTTTCGAGGAATTCTTCAGGGATTTCAATGAACTTTTTGCAGATTTCGGATCAATAACGCAAGTGGTTCCCGAGCTGCCAGGAGTGGATCCCCCATTGCAGAGGCCAGAGGTTCCTAGAGGAAAGTCACTTCGGGACTTCATGCTGAAATCCCCAGACTCGCACCTCCCAAGGGATCAGCCCCCACAATCCCAAAGCCCCAGCTCCCAGGCCCCTCCCAGACTTCCAAGGACAACACCGTGGGGCAGATACAGATGGGATGATGGGGAGGTTGGAATCTCACAAGGGGACACCAAGCAAGACCGAGATCTGGATTCAGAAGTCTCTTCTCGGGGTTTGGACACAATTCTGAGACCGGCAGAGCCGAGATCCTCCTCCTTTTTCCAGAGTGTTTCTGTGTCGAAGATTGTCAGACCCGATGGGACGATAGAGGAGAGACGCACTGTACGTGACGGCCAAGGGAACTCGAGCACCACAGTGACAGTGCAGAGAGGGGACGAGATCCTCAGCAGTGAGACTCAAGACGGCCCCCAGGCGCCAATCATTGGGGATCACATACACAGACCCCTCGGATCATTACTCCCCTCCCGAACTGTCCCAACTCCTCCGACTTTTACTCAGCAGGATCCTCCCCGAAAAGGGGTCCTTCCCGGCGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCCAGGATGATGATGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829342
dbEST ID: 79647044
Trimmed Sequence: TCGCTGGGAGAACCATTTCTGGAGGATCCTGCTGAGTAAAGTCTGAGAGTCGGACAGATCTGGAGGGGAGTAATGATCCGAGGGTCTGTGTATGTGATCCCCAATGTTTGGCCCCTGGGGGCCGTCTTGAGTCTCACTGCTGAGGATCTCGTCCCCTCTCTGCACTGTCACTGTGGTGCTCGAGTTCCCTTGGCCGTCACGTACAGTGCGTCTCTCCTCTATCGTCCCATCGGGTCTGACAATCTTCGACACAGAAACACTCTGGAAAAAGGAGGAGGATCTCGGCTCTGCCGGTCTCAGAATTGTGTCCAAACCCCGAGAAGAGACTTCTGAATCCAGATCTCGGTCTTGCTTGGTGTCCCCTTGTGAGATTCCAACCTCCCCATCATCCCATCTGTATCTGCCCCACGGTGTTGTCCTTGGAAGTCTGGGAGGGGCCTGGGAGCTGGGGCTTTGGGATTGTGGGGGCTGATCCCTTGGGAGGTGCGAGTCTGGGGATTTCAGCATGAAGTCCCGAAGTGACTTTCCTCTAGGAACCTCTGGCCTCTGCAATGGGGGATCCACTCCTGGCAGCTCGGGAACCACTTGCGTTATTGATCCGAAATCTGCAAAAAATTTCATTGAATCCCTGAAGAATTCCTCCAAACCAAAAACATTGGCCCTCGGGTCCCCGGCCCGGTCCAAATGGAAAACTCCAAGGGGGGAAACCGGGAAGGGCGAAAGGAAAAGGGGGAAAAACCAAAAGGTTTTTCCCCCTTTCC
Full Trace Sequence: GCGGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACTTGTTCGTTGCGCCAGGGGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCGCTGGGAGAACCATTTCTGGAGGATCCTGCTGAGTAAAGTCTGAGAGTCGGACAGATCTGGAGGGGAGTAATGATCCGAGGGTCTGTGTATGTGATCCCCAATGTTTGGCCCCTGGGGGCCGTCTTGAGTCTCACTGCTGAGGATCTCGTCCCCTCTCTGCACTGTCACTGTGGTGCTCGAGTTCCCTTGGCCGTCACGTACAGTGCGTCTCTCCTCTATCGTCCCATCGGGTCTGACAATCTTCGACACAGAAACACTCTGGAAAAAGGAGGAGGATCTCGGCTCTGCCGGTCTCAGAATTGTGTCCAAACCCCGAGAAGAGACTTCTGAATCCAGATCTCGGTCTTGCTTGGTGTCCCCTTGTGAGATTCCAACCTCCCCATCATCCCATCTGTATCTGCCCCACGGTGTTGTCCTTGGAAGTCTGGGAGGGGCCTGGGAGCTGGGGCTTTGGGATTGTGGGGGCTGATCCCTTGGGAGGTGCGAGTCTGGGGATTTCAGCATGAAGTCCCGAAGTGACTTTCCTCTAGGAACCTCTGGCCTCTGCAATGGGGGATCCACTCCTGGCAGCTCGGGAACCACTTGCGTTATTGATCCGAAATCTGCAAAAAATTTCATTGAATCCCTGAAGAATTCCTCCAAACCAAAAACATTGGCCCTCGGGTCCCCGGCCCGGTCCAAATGGAAAACTCCAAGGGGGGAAACCGGGAAGGGCGAAAGGAAAAGGGGGAAAAACCAAAAGGTTTTTCCCCCTTTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCGCTGGGAGAACCATTT