ORFeome > MGC53587 ORF2 – XORFeome v1.0

MGC53587 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 6251647
Gene Page ID: 5774338
ORF Xenbase ID: 17258199

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124926
Original XGC clone length: 1341

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ837481
dbEST ID: 79655183
Trimmed Sequence: ATGAAGTGCATTGTGGTCCTGCTGGTTGGTATCTCCATTGGATGGGTTCATTCCTGCAGCCCCCCACCAGGAGCGATCAATGTGGCAAGGTCGGGAGAAGCCAAGCAAAGCTCCACGTATGCACCTCGGTACATTGCTCAAGCAGCTAATGATGGCAGTAGAGCAACCAATCTCATCACAGGTCCATGCTCCAGCACTGCTAAGGACAATCCCGCCTGGTGGCAGGTGGACCTGAAGAAGGTCTACAAGGTTAACACTGTGGTCATTGTGAATAGAGGAGACTGCTGCAGGGAGCGCCTGTTAAAAGCTCAGATTCGTATCGGCAATTCCCCAAATAATGAAAACCCAATGTGCAGTATGATCACCGACATCACAAATCTTATCATCACTATGTGCTGTAACGGGATGGAGGGTCGGTATGTGAGTGTGGTTATTCCCGGGCGAGCAGAATATCTCAATATCTGTGAAGTGGAGGTCTACGGGGAAGAAGTTAAACCTGCTCAAGTTAATTTGACTAGACTGGGAGAAACCACACACATCTCAATTTACTGACCTGACTACCACACCACCTCCGCCATTGAAAGCAATATGAATACAAAAAAGAAGTTAGACAAAAGTTTCCCTCAATTGCTGGTGACAATCCCTGTTTGGTGGGCGGCTGGGACCCCAGGAGCACTTACCTTTTTTACTAAAAGGGGGGAAAAAAAAAAAAAAAAAAAAAATACTAAAGAGAAATGACCTTGGAAAAAGCCCCAAAACTCCTTAAAAGGAAAAAATTAAACCCAAAAAAAAAAAAAAACCCAAAAAAAACAGGCCCCCACAGAGGGGATTGTTC
Full Trace Sequence: TCGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGTGCATTGTGGTCCTGCTGGTTGGTATCTCCATTGGATGGGTTCATTCCTGCAGCCCCCCACCAGGAGCGATCAATGTGGCAAGGTCGGGAGAAGCCAAGCAAAGCTCCACGTATGCACCTCGGTACATTGCTCAAGCAGCTAATGATGGCAGTAGAGCAACCAATCTCATCACAGGTCCATGCTCCAGCACTGCTAAGGACAATCCCGCCTGGTGGCAGGTGGACCTGAAGAAGGTCTACAAGGTTAACACTGTGGTCATTGTGAATAGAGGAGACTGCTGCAGGGAGCGCCTGTTAAAAGCTCAGATTCGTATCGGCAATTCCCCAAATAATGAAAACCCAATGTGCAGTATGATCACCGACATCACAAATCTTATCATCACTATGTGCTGTAACGGGATGGAGGGTCGGTATGTGAGTGTGGTTATTCCCGGGCGAGCAGAATATCTCAATATCTGTGAAGTGGAGGTCTACGGGGAAGAAGTTAAACCTGCTCAAGTTAATTTGACTAGACTGGGAGAAACCACACACATCTCAATTTACTGACCTGACTACCACACCACCTCCGCCATTGAAAGCAATATGAATACAAAAAAGAAGTTAGACAAAAGTTTCCCTCAATTGCTGGTGACAATCCCTGTTTGGTGGGCGGCTGGGACCCCAGGAGCACTTACCTTTTTTACTAAAAGGGGGGAAAAAAAAAAAAAAAAAAAAAATACTAAAGAGAAATGACCTTGGAAAAAGCCCCAAAACTCCTTAAAAGGAAAAAATTAAACCCAAAAAAAAAAAAAAACCCAAAAAAAACAGGCCCCCACAGAGGGGATTGTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGTGCATTGTGGTCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837480
dbEST ID: 79655182
Trimmed Sequence: GTTTTCCAACCCAATAACCTCCACTTCACAGATATGGAGATATTCTACTCTCCCGGGAATCACCACACTCACGTACCGACCCACCATCCAGTTACAGGGCAGAGTGATGGGGTTTTTTGAGACGTCAGTGATGGTGCCGCATACGGGGTTGTTATTATCTGCTGAATTTCCAACACGGATCTCGGCTCCTTTCAGGCGCTCGCTGCAGCAGTCTCCTCTGTTCACTATGACAACTGAGTGAACCTTGTACATCTTCTTCAGGTCCAACTTCCACCAAGCAGGATTGTCACCACCAGTGTGGGAACATGAACCCAACATCACATTTGTCGCCTTATTGCCATCAATAGCTGCATCGGCGTTGTACTCACGTCTGTAAAGTGAGCTCTGTGTGGCCTCTCCCAGTCTCTCAACATTAGCTGGAACTTCTTGCCCGTCAGCCTCCACTTCACAAAGCTGGAGATATTCTGTTCTTCCGGATATAAGCACACTCACTTACCGACGCGCCATCTTGGTACGATACAGGTTGAGGATGCTTTGACTAGGATTATGTTCGCCCCAAACAGGTGTGGGTATATCTTCTTAATTTTCTATATAAACCTGAAACCCGCCCACTCCAATGGCTTTACATCTCCCCTCTCTCCGTAAGACCCAACTAAAAACAACATTTTTAAATCTTCCTTTAAGTCCAAACCACCCCCCACCCCAAGCAATGGTCACCAATCTAGTTAGAGGAAATCAAGGAAACCACAAAAATCGGTATTTTCTGCCTTTTGC
Full Trace Sequence: AAACAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTTTCCAACCCAATAACCTCCACTTCACAGATATGGAGATATTCTACTCTCCCGGGAATCACCACACTCACGTACCGACCCACCATCCAGTTACAGGGCAGAGTGATGGGGTTTTTTGAGACGTCAGTGATGGTGCCGCATACGGGGTTGTTATTATCTGCTGAATTTCCAACACGGATCTCGGCTCCTTTCAGGCGCTCGCTGCAGCAGTCTCCTCTGTTCACTATGACAACTGAGTGAACCTTGTACATCTTCTTCAGGTCCAACTTCCACCAAGCAGGATTGTCACCACCAGTGTGGGAACATGAACCCAACATCACATTTGTCGCCTTATTGCCATCAATAGCTGCATCGGCGTTGTACTCACGTCTGTAAAGTGAGCTCTGTGTGGCCTCTCCCAGTCTCTCAACATTAGCTGGAACTTCTTGCCCGTCAGCCTCCACTTCACAAAGCTGGAGATATTCTGTTCTTCCGGATATAAGCACACTCACTTACCGACGCGCCATCTTGGTACGATACAGGTTGAGGATGCTTTGACTAGGATTATGTTCGCCCCAAACAGGTGTGGGTATATCTTCTTAATTTTCTATATAAACCTGAAACCCGCCCACTCCAATGGCTTTACATCTCCCCTCTCTCCGTAAGACCCAACTAAAAACAACATTTTTAAATCTTCCTTTAAGTCCAAACCACCCCCCACCCCAAGCAATGGTCACCAATCTAGTTAGAGGAAATCAAGGAAACCACAAAAATCGGTATTTTCTGCCTTTTGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTTTCCAACCCAATAACCTCCA