ORFeome > MGC53685 ORF2 – XORFeome v1.0

MGC53685 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256318
Gene Page ID:
ORF Xenbase ID: 17258235

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110941
Original XGC clone length: 978

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: E02

Sequences - 5ʹ (forward) EST

Accession: JZ837696
dbEST ID: 79655398
Trimmed Sequence: ATGGCTACTAAACGTGTCGTAATGACTGGGCCTTCACCTTGGGGATTTCGGCTGGTTGGAGGGAAAGATTTCGAACAGCCCTTAACTATTTCAAGGGTAATGCCAGGAAGCAAAGCTGCAGTTGCGGATCTGTGTATCGGAGATGTAGTCATTGCTATTGATGGGGAAAACACAGATCGAATGACTCATTTAGAAGCACAGAATAAAATTAAGGGCTGTGAAGATGAATTAATTCTCACAATAAACAGGGCTGAATCGAAAATATGGTCTCCTCTTGCCTCTGAAGATGGAAAACCAAATCCATATAAGATGAACTTAGCAAGTAACCCACAGGAATTAAAACAAATAGGAAGTGCACATAATCGAAGTGCTTTGCCGTTCACTGCTGCCTCAGCTTCCAGCACCCCCAAAGTGATCACTGCTCAGTACAACAACCCAGCCGGCCTCTATTCTTCTGACAACATACAGAACTTCAATACTGCTCTGGAGAGCAAATCAACTCCCGTTGCCCAAGTACCAAGCAAAGCTTCAGAACAAACACAGCCAGCACATACCCGACACATTGATAAAGACTCGGAAGTTTACAAGATGCTGCAAGAGAATCAGGAATCAGAGGAAGCCCCTAGGCAGTCGACTTCTTTCTTGGTCCTGCAAGAGATCTTGGAATCTGACGAAACAAGGGGAAAAACCATCATGGGTTCCGAAGCGTAAGAGCACCCACCAACTAAATTCCCACCCCTCTGTGGG
Full Trace Sequence: TCGCGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTACTAAACGTGTCGTAATGACTGGGCCTTCACCTTGGGGATTTCGGCTGGTTGGAGGGAAAGATTTCGAACAGCCCTTAACTATTTCAAGGGTAATGCCAGGAAGCAAAGCTGCAGTTGCGGATCTGTGTATCGGAGATGTAGTCATTGCTATTGATGGGGAAAACACAGATCGAATGACTCATTTAGAAGCACAGAATAAAATTAAGGGCTGTGAAGATGAATTAATTCTCACAATAAACAGGGCTGAATCGAAAATATGGTCTCCTCTTGCCTCTGAAGATGGAAAACCAAATCCATATAAGATGAACTTAGCAAGTAACCCACAGGAATTAAAACAAATAGGAAGTGCACATAATCGAAGTGCTTTGCCGTTCACTGCTGCCTCAGCTTCCAGCACCCCCAAAGTGATCACTGCTCAGTACAACAACCCAGCCGGCCTCTATTCTTCTGACAACATACAGAACTTCAATACTGCTCTGGAGAGCAAATCAACTCCCGTTGCCCAAGTACCAAGCAAAGCTTCAGAACAAACACAGCCAGCACATACCCGACACATTGATAAAGACTCGGAAGTTTACAAGATGCTGCAAGAGAATCAGGAATCAGAGGAAGCCCCTAGGCAGTCGACTTCTTTCTTGGTCCTGCAAGAGATCTTGGAATCTGACGAAACAAGGGGAAAAACCATCATGGGTTCCGAAGCGTAAGAGCACCCACCAACTAAATTCCCACCCCTCTGTGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTACTAAACGTGTCGTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837695
dbEST ID: 79655397
Trimmed Sequence: TTTGGGGAACACGGTGACCACGTCGTATCCCTCAGGAGGTGTCATGCGCTCCCGTGCGTGCTTTTCACAGTACATCTTGTCTTCTACAAAGAAGTGGCCTTTCTGCTTGAGATTCATCCCGCAGTCAGTGCAAGCGTAGCATTCAGGGTGACGAGGTTTGTCCCGAATCTTCACAAATGCTCCCACAATGCCTGAGCCACAGTGATCACAAATTGGCAGTTTTTGTCCACTTCCCACAGAGGCTGCGACTTTAGTGGCGGGTGCTCTTACGCTTCGGAACCCAGATGGTTTTTCCCCTGTTTCGTCAGATTCCAAGATTTCCTGCAGGACCAAGAAAGAAGTCGACTGCCTAGGGGCTTCCTCTGATTCCTGATTCTCTTGCAGCATCTTGTAAACTTCCGAGTCTTTATCAATGTGTCGGGTATGTGCTGGCTGTGTTTGTTCTGAAGCTTTGCTTGGTACTTGGGCAACGGGAGTTGATTTGCTCTCCAGAGCAGTATTGAAGTTCTGTATGTTGTCAGAAGAATAGAGGCCGGCTGGGTTGTTGTACTGAGCAGTGATCACTTTGGGGGTGCTGGAAGCTGAGGCAGCAGTGAACCGGCAAGCACTTCGATTATGTGCACTTCCTATTTGTTTGAATTCCTGCGGCTGGCTTGCTAAGAGCATCTTACATAGATTGGGTTTTCGCTCTTCAGAGGCAAAGAGAAACAGGATTTTCCAATCACACCCTTTTACTGGGGGAGTGAGATTATCTTCCAAGCCTTGAGGTAATTCTGTGCTTCGAAGTGATTAGTGCGACGTGTTTTTGCGCGAGTCATCACGATGAAAACGGGTCCGATACACAGAATAGAAGCGGACGGGTTGGCTTCCGTCGGTTGCGGCGTGGAATACTGGAGGGCAGGGTCGGAAGGGTTCCCTCCCTCCCACCCCAGCACCCCCGAGGGTGAAGGGGCAGGGGGTAAAGAAAAAAATTAAAATAGACTTGGGTGTGGGGGTGTGTTTGTGGTTAAGTTGGTGTATGAGGAAAGAGGGGGGTGGTGGACCACGAATTTAAAAAAAAAAAAAACAGAAAAGAGAGAAAAAAAATAAGAATATGTGCTTTTCCTTCCGTTTGCCGGGCGGGAAAGAAGGTTGCGGGCGCCTCCCGCCCTTCTCCCAACTACACGCGGCGTCTCGGCGGGAAGAGAGAGACGCGCGCGCGCCNTGACACATATCTTTAATAT
Full Trace Sequence: GGGCAGGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTGGGGAACACGGTGACCACGTCGTATCCCTCAGGAGGTGTCATGCGCTCCCGTGCGTGCTTTTCACAGTACATCTTGTCTTCTACAAAGAAGTGGCCTTTCTGCTTGAGATTCATCCCGCAGTCAGTGCAAGCGTAGCATTCAGGGTGACGAGGTTTGTCCCGAATCTTCACAAATGCTCCCACAATGCCTGAGCCACAGTGATCACAAATTGGCAGTTTTTGTCCACTTCCCACAGAGGCTGCGACTTTAGTGGCGGGTGCTCTTACGCTTCGGAACCCAGATGGTTTTTCCCCTGTTTCGTCAGATTCCAAGATTTCCTGCAGGACCAAGAAAGAAGTCGACTGCCTAGGGGCTTCCTCTGATTCCTGATTCTCTTGCAGCATCTTGTAAACTTCCGAGTCTTTATCAATGTGTCGGGTATGTGCTGGCTGTGTTTGTTCTGAAGCTTTGCTTGGTACTTGGGCAACGGGAGTTGATTTGCTCTCCAGAGCAGTATTGAAGTTCTGTATGTTGTCAGAAGAATAGAGGCCGGCTGGGTTGTTGTACTGAGCAGTGATCACTTTGGGGGTGCTGGAAGCTGAGGCAGCAGTGAACCGGCAAGCACTTCGATTATGTGCACTTCCTATTTGTTTGAATTCCTGCGGCTGGCTTGCTAAGAGCATCTTACATAGATTGGGTTTTCGCTCTTCAGAGGCAAAGAGAAACAGGATTTTCCAATCACACCCTTTTACTGGGGGAGTGAGATTATCTTCCAAGCCTTGAGGTAATTCTGTGCTTCGAAGTGATTAGTGCGACGTGTTTTTGCGCGAGTCATCACGATGAAAACGGGTCCGATACACAGAATAGAAGCGGACGGGTTGGCTTCCGTCGGTTGCGGCGTGGAATACTGGAGGGCAGGGTCGGAAGGGTTCCCTCCCTCCCACCCCAGCACCCCCGAGGGTGAAGGGGCAGGGGGTAAAGAAAAAAATTAAAATAGACTTGGGTGTGGGGGTGTGTTTGTGGTTAAGTTGGTGTATGAGGAAAGAGGGGGGTGGTGGACCACGAATTTAAAAAAAAAAAAAACAGAAAAGAGAGAAAAAAAATAAGAATATGTGCTTTTCCTTCCGTTTGCCGGGCGGGAAAGAAGGTTGCGGGCGCCTCCCGCCCTTCTCCCAACTACACGCGGCGTCTCGGCGGGAAGAGAGAGACGCGCGCGCGCCNTGACACATATCTTTAATAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGGGGAACACGGTGAC