ORFeome > MGC53786 ORF1 – XORFeome v1.0

MGC53786 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256081
Gene Page ID:
ORF Xenbase ID: 17258277

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC046731
Original XGC clone length: 948

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11012
Well Location: E10

Sequences - 5ʹ (forward) EST

Accession: JZ823996
dbEST ID: 79641698
Trimmed Sequence: ATGCAGCTGGTTCCATTATTGGGAAAGGGGGTCAGACAATTGTCCAGCTGCAGCGAGAGACAGGAGCTACAATCAAACTGTCAAAGTCCAAGGACTTTTACCCAGGCAAAACTTATTGTTCCAAACACAACCGCAGGACTTATTATTGGCAAGGGAGGTGCCACTGTCCGCAACATTATGGAGGAATCAGGAGCCTGGGTTCAGCTCTCCCAAAAGCCTGCGGGACCCAATCTCCATGAGCGAGTGGTGACAGTGAGTGGAGAGCCTAATCAAGTCCAGAAGGCAATATGCAGTATTATCCACAAATCCCGTGAAGACCCACCACAAGGAACCACCCACCTTAACATAAGTTACATCAACACACAGGGTCCAGTAGCCAACTCAAACCCCACTGGCTCACCTTACGCTGGTGGAACAGCAGAGCCAGTGCTTACTCCCTTTTCACCAGCTCCACCAGCTCCACCAGCCATCACAGGAGGAGACCTACTAGCCATTTCTTCTGCCCTTAATACTCTAGCCAGCTATGGTTATAGTACAGGGATGGGCTACAATCCTCTAGTAGGAGGAGTCCATCCAGCTGCAGTTAATCTTCTTGCTTCTTACACAGGGGAAACTGGTCCAGCTTTGGGACTGGGAGGGGGAGGGATACTTTTGGAGAAGATGGGGGCTGAAAGTCTGGCAGGTAAAGAGACCCTGGAGATGGCTGTTCCAGAGACACTAGTAGGTGCAATCTTGGGGAAGGGTGCCAAGAACTTTGGTTGGAATACCAGGGAGCTAACAA
Full Trace Sequence: AATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGCTGGTTCCATTATTGGGAAAGGGGGTCAGACAATTGTCCAGCTGCAGCGAGAGACAGGAGCTACAATCAAACTGTCAAAGTCCAAGGACTTTTACCCAGGCAAAACTTATTGTTCCAAACACAACCGCAGGACTTATTATTGGCAAGGGAGGTGCCACTGTCCGCAACATTATGGAGGAATCAGGAGCCTGGGTTCAGCTCTCCCAAAAGCCTGCGGGACCCAATCTCCATGAGCGAGTGGTGACAGTGAGTGGAGAGCCTAATCAAGTCCAGAAGGCAATATGCAGTATTATCCACAAATCCCGTGAAGACCCACCACAAGGAACCACCCACCTTAACATAAGTTACATCAACACACAGGGTCCAGTAGCCAACTCAAACCCCACTGGCTCACCTTACGCTGGTGGAACAGCAGAGCCAGTGCTTACTCCCTTTTCACCAGCTCCACCAGCTCCACCAGCCATCACAGGAGGAGACCTACTAGCCATTTCTTCTGCCCTTAATACTCTAGCCAGCTATGGTTATAGTACAGGGATGGGCTACAATCCTCTAGTAGGAGGAGTCCATCCAGCTGCAGTTAATCTTCTTGCTTCTTACACAGGGGAAACTGGTCCAGCTTTGGGACTGGGAGGGGGAGGGATACTTTTGGAGAAGATGGGGGCTGAAAGTCTGGCAGGTAAAGAGACCCTGGAGATGGCTGTTCCAGAGACACTAGTAGGTGCAATCTTGGGGAAGGGTGCCAAGAACTTTGGTTGGAATACCAGGGAGCTAACAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGCTGGTTCCATTATTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829304
dbEST ID: 79647006
Trimmed Sequence: CCCAACCTTTTGGGGATTGCTGCACCTCACCCCTTGCTCATAGGCCACCCTCTGACCAATTAAATATTGTGCTGCCTGTGTAGCCCCTGGAGGCCCTGTGATGGTCACCTTTCGACTTCTTGTCCCTGGTACAAATTCTCCTTTTTTGGAAATTTGAATGCGAGCTCCTGTTAGCTCCTGGTATTCAACCAAAGTCTTGCCACCCTTTCCCAAGATTGCACCTACTAGTGTCTCTGGAACAGCCATCTCCAGGGTCTCTTTACCTGCCAGACTTTCAGCCCCCATCTTCTCCAAAAGTATCCCTCCCCCTCCCAGTCCCAAAGCTGGACCAGTTTCCCCTGTGTAAGAAGCAAGAAGATTAACTGCAGCTGGATGGACTCCTCCTACTAGAGGATTGTAGCCCATCCCTGTACTATAACCATAGCTGGCTAGAGTATTAAGGGCAGAAGAAATGGCTAGTAGGTCTCCTCCTGTGATGGCTGGTGGAGCTGGTGGAGCTGGTGAAAAGGGAGTAAGCACTGGCTCTGCTGTTCCACCGCGTAAGGTGAGCCAGTGGGGTTTGAGTTGGCTACGGGACCCTGTGTGTTGATGTAACTTATGTTAAGGGGGGTGGTTCCTTGTGGTGGGTCTTCACGGGATTTGTGGGATAAACTGCAATATTGCCTCCTGGAACTGAATAAAGGCTTCCCACCCACGGGTCCCCACTCGCTTAAGGGAAAAATTGGGTTCCCCCCAGGGCCTTTTTGGGAAAAACCG
Full Trace Sequence: CGGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCCAACCTTTTGGGGATTGCTGCACCTCACCCCTTGCTCATAGGCCACCCTCTGACCAATTAAATATTGTGCTGCCTGTGTAGCCCCTGGAGGCCCTGTGATGGTCACCTTTCGACTTCTTGTCCCTGGTACAAATTCTCCTTTTTTGGAAATTTGAATGCGAGCTCCTGTTAGCTCCTGGTATTCAACCAAAGTCTTGCCACCCTTTCCCAAGATTGCACCTACTAGTGTCTCTGGAACAGCCATCTCCAGGGTCTCTTTACCTGCCAGACTTTCAGCCCCCATCTTCTCCAAAAGTATCCCTCCCCCTCCCAGTCCCAAAGCTGGACCAGTTTCCCCTGTGTAAGAAGCAAGAAGATTAACTGCAGCTGGATGGACTCCTCCTACTAGAGGATTGTAGCCCATCCCTGTACTATAACCATAGCTGGCTAGAGTATTAAGGGCAGAAGAAATGGCTAGTAGGTCTCCTCCTGTGATGGCTGGTGGAGCTGGTGGAGCTGGTGAAAAGGGAGTAAGCACTGGCTCTGCTGTTCCACCGCGTAAGGTGAGCCAGTGGGGTTTGAGTTGGCTACGGGACCCTGTGTGTTGATGTAACTTATGTTAAGGGGGGTGGTTCCTTGTGGTGGGTCTTCACGGGATTTGTGGGATAAACTGCAATATTGCCTCCTGGAACTGAATAAAGGCTTCCCACCCACGGGTCCCCACTCGCTTAAGGGAAAAATTGGGTTCCCCCCAGGGCCTTTTTGGGAAAAACCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCCAACCTTTTGGGGATTGCT