ORFeome > MGC53953 ORF1 – XORFeome v1.0

MGC53953 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6251645
Gene Page ID:
ORF Xenbase ID: 17258337

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042215
Original XGC clone length: 507

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11015
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ824271
dbEST ID: 79641973
Trimmed Sequence: ATGAATAATAAAGGACAATACCCTTCTGCCCCAGCCTACCCAACCCAGGCACCCAATTCTCAGTCAGTGTACCCACCAACCATGCACCTGCCACAGGCTCCTTCTTATACAGATGCACCTCCAGCTTATTCTGAGCTGTACCGAGCTGCGTATATGCAACAAGCAGCAGCTAATATGAGCGCTCTATCTGCACACTACCCCAGCACATCAATGTACCTTCCTATGGCTCAGCCTATGCAAGTTGCACAAATGTCCTCACAAGTACCTATGGCTTATTACCCTATTGGTCCTGTCTACCCACCTGGCTCCACAGTCCTTGTCGATGGGGGCTATGATGCAGGGGCTCGATTTGGTGTGGGTAACTCTCCATCGGTTCCACCACCGCCAACCGGCTGCCCCCCGAATGCAGCTCAGCTGGCTGCCATGCAGGGTGCAAATGTATTAGTCACACAGAGGAAAGGCAATTACTTCATGGGTGGCTCAGATGGTGGATACACCATTTGGTT
Full Trace Sequence: GGCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATAATAAAGGACAATACCCTTCTGCCCCAGCCTACCCAACCCAGGCACCCAATTCTCAGTCAGTGTACCCACCAACCATGCACCTGCCACAGGCTCCTTCTTATACAGATGCACCTCCAGCTTATTCTGAGCTGTACCGAGCTGCGTATATGCAACAAGCAGCAGCTAATATGAGCGCTCTATCTGCACACTACCCCAGCACATCAATGTACCTTCCTATGGCTCAGCCTATGCAAGTTGCACAAATGTCCTCACAAGTACCTATGGCTTATTACCCTATTGGTCCTGTCTACCCACCTGGCTCCACAGTCCTTGTCGATGGGGGCTATGATGCAGGGGCTCGATTTGGTGTGGGTAACTCTCCATCGGTTCCACCACCGCCAACCGGCTGCCCCCCGAATGCAGCTCAGCTGGCTGCCATGCAGGGTGCAAATGTATTAGTCACACAGAGGAAAGGCAATTACTTCATGGGTGGCTCAGATGGTGGATACACCATTTGGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCATGTCTAAAAAAACAAAAAAAATTTAAAAAAANNNNNTNNNNGTNTTTTCTTGTTTCCCGGGGGGTTCCCCTTTCGGCCCTCCCGGGGCTTTTTCCTTTTTTTTCCCCCCGGCTCTTTTCCGGGGGGCGGGTCGTGTGCTGGCGTTGCTCGCTTTTGTTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATAATAAAGGACAATACC

Sequences - 3ʹ (reverse) EST

Accession: JZ829597
dbEST ID: 79647299
Trimmed Sequence: CCAAATGGTGTATCCACCATCTGAGCCACCCATGAAGTAATTGCCTTTCCTCTGTGTGACTAATACATTTGCACCCTGCATGGCAGCCAGCTGAGCTGCATTCGGGGGGCAGCCGGTTGGCGGTGGTGGAACCGATGGAGAGTTACCCACACCAAATCGAGCCCCTGCATCATAGCCCCCATCGACAAGGACTGTGGAGCCAGGTGGGTAGACAGGACCAATAGGGTAATAAGCCATAGGTACTTGTGAGGACATTTGTGCAACTTGCATAGGCTGAGCCATAGGAAGGTACATTGATGTGCTGGGGTAGTGTGCAGATAGAGCGCTCATATTAGCTGCTGCTTGTTGCATATACGCAGCTCGGTACAGCTCAGAATAAGCTGGAGGTGCATCTGTATAAGAAGGAGCCTGTGGCAGGTGCATGGTTGGTGGGTACACTGACTGAGAATTGGGTGCCTGGGTTGGGTAGGCTGGGGCAGAAGGGTATTGTCCTTTATTATTCATGG
Full Trace Sequence: CCGGCAGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCAAATGGTGTATCCACCATCTGAGCCACCCATGAAGTAATTGCCTTTCCTCTGTGTGACTAATACATTTGCACCCTGCATGGCAGCCAGCTGAGCTGCATTCGGGGGGCAGCCGGTTGGCGGTGGTGGAACCGATGGAGAGTTACCCACACCAAATCGAGCCCCTGCATCATAGCCCCCATCGACAAGGACTGTGGAGCCAGGTGGGTAGACAGGACCAATAGGGTAATAAGCCATAGGTACTTGTGAGGACATTTGTGCAACTTGCATAGGCTGAGCCATAGGAAGGTACATTGATGTGCTGGGGTAGTGTGCAGATAGAGCGCTCATATTAGCTGCTGCTTGTTGCATATACGCAGCTCGGTACAGCTCAGAATAAGCTGGAGGTGCATCTGTATAAGAAGGAGCCTGTGGCAGGTGCATGGTTGGTGGGTACACTGACTGAGAATTGGGTGCCTGGGTTGGGTAGGCTGGGGCAGAAGGGTATTGTCCTTTATTATTCATGGTGCCAACTTTTTTGTACAAGGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACATGTCACTATCAGTCAAAAATAAATCCATTTATTTGAAGCACGAAGCTTAACACTGGACGTCGTTTAAAATCTGCTCTTTGTTATATGGGAAATNCCCCGTGTACAGGTCTAGTGGTAAGAATGTGTCCATTCAATTTATGGTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCAAATGGTGTATCCACCATCT