ORFeome > MGC64293 ORF1 – XORFeome v1.0

MGC64293 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6255777
Gene Page ID:
ORF Xenbase ID: 17258367

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053770
Original XGC clone length: 414

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: JZ839094
dbEST ID: 79656796
Trimmed Sequence: ATGTCTTGGAACGGCTACATCGATAACCTGACGTGCGAGAAAGTGCAGGAGGCGTGTATCTGCGGCTACAAGGGGACCCCGTCCGTATGGGCCTGCACTCCCGGCGGAGTCTTCAGCAACATAACGCCTGCTGAGATCAATGCGTTGGTGTCGCCCAACCGAGAGTCGCTATTTGTCAATGGTCTGACCATAGGCGGAGTCAAGTGCTCCGTGCTCAGGGACGAGTTCGCTGTGGTCGACAACCAGGTGATGGATCTGAGGACCAAGAACCCCAACGGGCCCACCTACAATGTCTCCATCTGCAAAACTGAGCAAGCTCTGGTCATGGTCATGGGGAAGGCCGAGGTGCACGGGGGGTGTCTGAACAAGAAAGTCTTTGACATGGGCAAGTACCTGAGATGTTCTGGCTACTT
Full Trace Sequence: GAAGGTTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTTGGAACGGCTACATCGATAACCTGACGTGCGAGAAAGTGCAGGAGGCGTGTATCTGCGGCTACAAGGGGACCCCGTCCGTATGGGCCTGCACTCCCGGCGGAGTCTTCAGCAACATAACGCCTGCTGAGATCAATGCGTTGGTGTCGCCCAACCGAGAGTCGCTATTTGTCAATGGTCTGACCATAGGCGGAGTCAAGTGCTCCGTGCTCAGGGACGAGTTCGCTGTGGTCGACAACCAGGTGATGGATCTGAGGACCAAGAACCCCAACGGGCCCACCTACAATGTCTCCATCTGCAAAACTGAGCAAGCTCTGGTCATGGTCATGGGGAAGGCCGAGGTGCACGGGGGGTGTCTGAACAAGAAAGTCTTTGACATGGGCAAGTACCTGAGATGTTCTGGCTACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCACCTAAAAACCGAGACACAAAATCATTAAATGTTCAGGGNNNNNNCNGGGNNNNNNNNAAGNCCGCGCCCCCTCGCGACCAGGGGTTCAAAAAAAAAAAAAAGTTGAATGTAAGAGTAACCCCCAGAACACGAAAAAACACACGGGGGGGCGGTGTGAAATTGGTGGGGCCCNCGCGCGGGGCGCCGGCNACGCGGGGGGGCAGAAAGAGGGAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTTGGAACGGCTAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839093
dbEST ID: 79656795
Trimmed Sequence: GTAGCCAGAACATCTCAGGTACTTGCCCATGTCAAAGACTTTCTTGTTCAGACACCCCCCGTGCACCTCGGCCTTCCCCATGACCATGACCAGAGCTTGCTCAGTTTTGCAGATGGAGACATTGTAGGTGGGCCCGTTGGGGTTCTTGGTCCTCAAATCCATCACCTGGTTGTCGACCACAGCGAACTCGTCCCTGAGCACGGAGCACTTGACTCCGCCTATGGTCAGACCATTGACAAATAGCGACTCTCGGTTGGGCGACACCAACGCATTGATCTCAGCAGGCGTTATGTTGCTGAAGACTCCGCCGGGAGTGCAGGCCCATACGGACGGGGTCCCCTTGTAGCCGCAGATACACGCCTCCTGCACTTTCTCGCACGTCAGGTTATCGATGTAGCCGTTCCCACACATGG
Full Trace Sequence: GGGTAAACTGCTATAGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAGCCAGAACATCTCAGGTACTTGCCCATGTCAAAGACTTTCTTGTTCAGACACCCCCCGTGCACCTCGGCCTTCCCCATGACCATGACCAGAGCTTGCTCAGTTTTGCAGATGGAGACATTGTAGGTGGGCCCGTTGGGGTTCTTGGTCCTCAAATCCATCACCTGGTTGTCGACCACAGCGAACTCGTCCCTGAGCACGGAGCACTTGACTCCGCCTATGGTCAGACCATTGACAAATAGCGACTCTCGGTTGGGCGACACCAACGCATTGATCTCAGCAGGCGTTATGTTGCTGAAGACTCCGCCGGGAGTGCAGGCCCATACGGACGGGGTCCCCTTGTAGCCGCAGATACACGCCTCCTGCACTTTCTCGCACGTCAGGTTATCGATGTAGCCGTTCCCACACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAATCCAAATTAAATCATTATTTGGGGCCCGACCTTAAGAAAAAAAAACAATAAAAACATAATAAAAAGGGCGGAAAGCACCGCTGAAAAAAAGACCTCCTCTCCCGGAAACCAGGTTTCCGAATAAAACCTCCTGGGAAAAAGGAAAAGGAAAAACCAGAAGGAGAAAAGCGGTGGGAGGTTAATATGGAGGATGGGACGAGGGGGGCGCCCCAACCCCTGGAGGAAAGTGGTATAAGAAAAAGCGGGGGTGGGGGNGAGGAAGAGTATTTGTGCCGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAGCCAGAACATCTCAGGTA