ORFeome > MGC64309 ORF1 – XORFeome v1.0

MGC64309 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6255494
Gene Page ID:
ORF Xenbase ID: 17258385

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054954
Original XGC clone length: 1518

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: E03

Sequences - 5ʹ (forward) EST

Accession: JZ839180
dbEST ID: 79656882
Trimmed Sequence: ATGATGCGTGCTAGATTTGTTTTCTGCTGTACTCTATTGGTCGTCGCCAGGGCCGATATTCTGGAGGAGCAGGACGTGCTGGTGCTCAAGAAAGACAACTTTGATGAGGCGCTCAAACAGAATCAGTTTATCCTAGTGGAGTTCTATGCTCCCTGGTGTGGCCACTGCAAGGCACTTGCTCCAGAATATGAGAAGGCTGCTGGCATATTAAAAAGTGAAGGTTTATCAATACGCTTGGGCAAGGTAGATGCAACAGAAGAGTCTGATCTGGCTCAGGAGTTTGGCGTTCGAGGTTACCCAACAATCAAATTCTTCAAAAATGGAGACAAGTCTTCTCCTAAAGAATATTCAGCTGGCAGGGAGGCAGCAGATATTGTCAACTGGCTGAAGAAGCGTACTGGTCCAGCTGCCAGTGTTCTGAGTGATGAGGCAGCTGTTGCAGCTTTGGTGGATTCCAGTGAGGTTGCCGTTATTGGTTTCTTTAAGGATCCAGAGTCGGAGCTAGCTAAAGTGTTTCTGAAAGCAGCTGAGGCAGTAGATGATATTCCATTTGGCATCACATCCAGCGATGCAGCCTTCTCAAAACACGAACTCAGCAAGGATGGCATTGTTGTGTTTAAGAAGTTTGATGAAGGCCGAAATACATTTAAGGGAGAGAACACAAAGGAAGAACTTTTTACCTTCATAAAGGCAATTCCGTTGCCTCTCGTTTAAGAATTTACTGGACAAAAGGCTCCAATGAATCTTTGGTTGGAAGAATTTAAAAATTCATATTC
Full Trace Sequence: CTCGGGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGCGTGCTAGATTTGTTTTCTGCTGTACTCTATTGGTCGTCGCCAGGGCCGATATTCTGGAGGAGCAGGACGTGCTGGTGCTCAAGAAAGACAACTTTGATGAGGCGCTCAAACAGAATCAGTTTATCCTAGTGGAGTTCTATGCTCCCTGGTGTGGCCACTGCAAGGCACTTGCTCCAGAATATGAGAAGGCTGCTGGCATATTAAAAAGTGAAGGTTTATCAATACGCTTGGGCAAGGTAGATGCAACAGAAGAGTCTGATCTGGCTCAGGAGTTTGGCGTTCGAGGTTACCCAACAATCAAATTCTTCAAAAATGGAGACAAGTCTTCTCCTAAAGAATATTCAGCTGGCAGGGAGGCAGCAGATATTGTCAACTGGCTGAAGAAGCGTACTGGTCCAGCTGCCAGTGTTCTGAGTGATGAGGCAGCTGTTGCAGCTTTGGTGGATTCCAGTGAGGTTGCCGTTATTGGTTTCTTTAAGGATCCAGAGTCGGAGCTAGCTAAAGTGTTTCTGAAAGCAGCTGAGGCAGTAGATGATATTCCATTTGGCATCACATCCAGCGATGCAGCCTTCTCAAAACACGAACTCAGCAAGGATGGCATTGTTGTGTTTAAGAAGTTTGATGAAGGCCGAAATACATTTAAGGGAGAGAACACAAAGGAAGAACTTTTTACCTTCATAAAGGCAATTCCGTTGCCTCTCGTTTAAGAATTTACTGGACAAAAGGCTCCAATGAATCTTTGGTTGGAAGAATTTAAAAATTCATATTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGCGTGCTAGATTTGTTTTC

Sequences - 3ʹ (reverse) EST

Accession: JZ839179
dbEST ID: 79656881
Trimmed Sequence: TAATTCATCTTTTGTATGTACTTCATCTCCCTCCTCCAAATCAGTTTCATCAGCATCTTCTAAATCTTCAAGATCCTCATCAGCAGCTCCATCCTGCCCCCCACTCTCCAAAAACTTTGAAAAGCCTTCTAGGGTCCTTTCGCCATTATAATCAGCCACCTTTCCTGGTCCAGCAGGGAAAAACTTCAGTGTAGGGAAGCTGTGAATCTTAACAGCTTCTATCTCATTAACTGTAGAATCCATCTTGGCAATAATGATGCTATCGTGGTTCTTATACTTCTCCCCCAACTGGTCCCAGATTGGTGCCAGTTGCTTGCAGTGGCCACACCATGGAGCATAGAATTCTACAAGTACATTCTTCTCCTCATCAAAGGCCACTTCCTCAAAGTTCTTCCCCACCAATACTTTCACAGGGTTTTTGTCCCAGTCTTCTGGAACATCCTGGCTCATTAAGTGTGGCTTGACTTTTCCCTCTAGGAAACTGTCACAGAACTCTTTAATGGCCTCAGCTGAAAGATCAGCACTCTCTGGCTTGTATTTTGTCATTTCTTCCTCCAAAGTAATAAGCCGTACAGTTGGGCATTCTTCCTTCTTTAAGCCAAAGAACTCCAGAATACGCTGGTTGTCAATGTGATCACTATCAATAAAGATGAAAAAGAATCTTTCCTTTGAAGCTTTCGGCTGCCCTCTTAAAATTCTCTAAATTTGTCTTTTGTAATCCATAACCACTTTTTCGGGCAAAAAAAAAAAAAAAAAAATTAAAATCT
Full Trace Sequence: CCGTGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAATTCATCTTTTGTATGTACTTCATCTCCCTCCTCCAAATCAGTTTCATCAGCATCTTCTAAATCTTCAAGATCCTCATCAGCAGCTCCATCCTGCCCCCCACTCTCCAAAAACTTTGAAAAGCCTTCTAGGGTCCTTTCGCCATTATAATCAGCCACCTTTCCTGGTCCAGCAGGGAAAAACTTCAGTGTAGGGAAGCTGTGAATCTTAACAGCTTCTATCTCATTAACTGTAGAATCCATCTTGGCAATAATGATGCTATCGTGGTTCTTATACTTCTCCCCCAACTGGTCCCAGATTGGTGCCAGTTGCTTGCAGTGGCCACACCATGGAGCATAGAATTCTACAAGTACATTCTTCTCCTCATCAAAGGCCACTTCCTCAAAGTTCTTCCCCACCAATACTTTCACAGGGTTTTTGTCCCAGTCTTCTGGAACATCCTGGCTCATTAAGTGTGGCTTGACTTTTCCCTCTAGGAAACTGTCACAGAACTCTTTAATGGCCTCAGCTGAAAGATCAGCACTCTCTGGCTTGTATTTTGTCATTTCTTCCTCCAAAGTAATAAGCCGTACAGTTGGGCATTCTTCCTTCTTTAAGCCAAAGAACTCCAGAATACGCTGGTTGTCAATGTGATCACTATCAATAAAGATGAAAAAGAATCTTTCCTTTGAAGCTTTCGGCTGCCCTCTTAAAATTCTCTAAATTTGTCTTTTGTAATCCATAACCACTTTTTCGGGCAAAAAAAAAAAAAAAAAAATTAAAATCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAATTCATCTTTTGTATGTACTTC