ORFeome > MGC64326 ORF1 – XORFeome v1.0

MGC64326 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6255808
Gene Page ID:
ORF Xenbase ID: 17258391

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054187
Original XGC clone length: 1032

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: G02

Sequences - 5ʹ (forward) EST

Accession: JZ839202
dbEST ID: 79656904
Trimmed Sequence: ATGTCTTTTATGCAGGAATTCCTTGCTCAGGCTTCCTTCCTGGAAGGTGGAGGGCATCCTCCATGCACTGCTGAAGAATCTGGTCCGTCTCTCAAAGCAAATCCTGGATTCAATGCTGCAGCTGATGCGGCAAACTTGGATAAAGCCATTAAAGCAAAAGGTGTTGATGAAGGAACCATCATTGACATCCTGACAAAAAGAACCAACTCTGAACGACAGCAAATCAGAGCTGCTTATCAACAATTAACAGGGAAGTCACTAGATGATGCCTTGAAGAAGTGCCTCAAAAGTCACCTGGAGGAAGTTGTCCTTGGTTTACTTAAAACTCCAGCCCAGTTTGATGCCCAGGAGTTGAGAGGTGCCATCAAGGGACTTGGAACAGATGAGGACAGTTTGATTGAGATCTTGGTATCACGGACCAATTCTGAAATGAGAGAAATTAACAAGGTTTATAAAGAAGAATATAAAAGGGAACTTGCAAAGGACATTGCTGGTGACACATCAGGAGATTTCCAGAAAACTCTCCTTGCACTTGCTAAGGGGGAGCGGAACGAGGATACACGTGTCAATGAAGATCAGGCTGACAATGATGCCAGGGCATTGTACGAAGCTGGAGAGAAAAGGAAAGGAACTGATGTGCCTACATTCATCAACATTTTAACTACTAGAAGTTTCCCACTTATTCAAAAAGTTTTACCAAGATATGCAAGAATATAGCAAAAATGGATCTGAACAAGGGCAATTGAATCCTGAAGAATAAA
Full Trace Sequence: CTCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTTTTATGCAGGAATTCCTTGCTCAGGCTTCCTTCCTGGAAGGTGGAGGGCATCCTCCATGCACTGCTGAAGAATCTGGTCCGTCTCTCAAAGCAAATCCTGGATTCAATGCTGCAGCTGATGCGGCAAACTTGGATAAAGCCATTAAAGCAAAAGGTGTTGATGAAGGAACCATCATTGACATCCTGACAAAAAGAACCAACTCTGAACGACAGCAAATCAGAGCTGCTTATCAACAATTAACAGGGAAGTCACTAGATGATGCCTTGAAGAAGTGCCTCAAAAGTCACCTGGAGGAAGTTGTCCTTGGTTTACTTAAAACTCCAGCCCAGTTTGATGCCCAGGAGTTGAGAGGTGCCATCAAGGGACTTGGAACAGATGAGGACAGTTTGATTGAGATCTTGGTATCACGGACCAATTCTGAAATGAGAGAAATTAACAAGGTTTATAAAGAAGAATATAAAAGGGAACTTGCAAAGGACATTGCTGGTGACACATCAGGAGATTTCCAGAAAACTCTCCTTGCACTTGCTAAGGGGGAGCGGAACGAGGATACACGTGTCAATGAAGATCAGGCTGACAATGATGCCAGGGCATTGTACGAAGCTGGAGAGAAAAGGAAAGGAACTGATGTGCCTACATTCATCAACATTTTAACTACTAGAAGTTTCCCACTTATTCAAAAAGTTTTACCAAGATATGCAAGAATATAGCAAAAATGGATCTGAACAAGGGCAATTGAATCCTGAAGAATAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTTTTATGCAGGAATTCCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839201
dbEST ID: 79656903
Trimmed Sequence: GTTGTCAGATCCACACAAGGCCAACATAATGGTTTCATAATCGCCTTTAAGTTTCTCTTCCATAACAGCCTGGCGGAGAGATTTGCCATAAAGTCGTTTATAGCAGGTTTTAATTTCTTTGAGGTCAATTTCAGATCTGGAAACCAGAACTCTAATTAAAGCATTGTGCCGAGTTCCAGATCCCTTCATGGCCAGATAGAATCTTTCAGCAAAGAAAGCGGGTTTAGAGCTAGCACATTTCACTAAACTCATTAAGCATTTTTCAAGATCTCCTTTCATCTCAAGATCAATTGCCTTGTTCAGATCATTTTTGCTATATCTTGCATATCTTTGTAAAACTTTCTGAATATGTGGGAAACTTCTAGTAGTTAAAATGTTGATGAATGTAGGCACATCAGTTCCTTTCCTCTTCTCTCCAGCTTCGTACAATGCCCTGGCATCATTGTCAGCCTGATCTTCATTGACACGTGTATCCTCGTTCCGCTCCCCCTTAGCAAGTGCAAGGAGAGTTTTCTGGAAATCTCCTGATGTGTCACCAGCAATGTCCTTTGCAAGTTCCCTTTTATATTCTTCTTTATAAACCTTGGTTAATTTCTCTCATTTCAAAATTGGGTCCTGGATACCAAAATCTCAATCAAACTGTCCTCATCTGGTTCAAGTCCCTTGAGGGCACCTCTCAACTCCTGGGGATTCAACTGGGGCGGGAATTTAAAAGTAAACCAAAGAAC
Full Trace Sequence: CCGAGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGTCAGATCCACACAAGGCCAACATAATGGTTTCATAATCGCCTTTAAGTTTCTCTTCCATAACAGCCTGGCGGAGAGATTTGCCATAAAGTCGTTTATAGCAGGTTTTAATTTCTTTGAGGTCAATTTCAGATCTGGAAACCAGAACTCTAATTAAAGCATTGTGCCGAGTTCCAGATCCCTTCATGGCCAGATAGAATCTTTCAGCAAAGAAAGCGGGTTTAGAGCTAGCACATTTCACTAAACTCATTAAGCATTTTTCAAGATCTCCTTTCATCTCAAGATCAATTGCCTTGTTCAGATCATTTTTGCTATATCTTGCATATCTTTGTAAAACTTTCTGAATATGTGGGAAACTTCTAGTAGTTAAAATGTTGATGAATGTAGGCACATCAGTTCCTTTCCTCTTCTCTCCAGCTTCGTACAATGCCCTGGCATCATTGTCAGCCTGATCTTCATTGACACGTGTATCCTCGTTCCGCTCCCCCTTAGCAAGTGCAAGGAGAGTTTTCTGGAAATCTCCTGATGTGTCACCAGCAATGTCCTTTGCAAGTTCCCTTTTATATTCTTCTTTATAAACCTTGGTTAATTTCTCTCATTTCAAAATTGGGTCCTGGATACCAAAATCTCAATCAAACTGTCCTCATCTGGTTCAAGTCCCTTGAGGGCACCTCTCAACTCCTGGGGATTCAACTGGGGCGGGAATTTAAAAGTAAACCAAAGAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGTCAGATCCACACAAG