ORFeome > MGC64358 ORF1 – XORFeome v1.0

MGC64358 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6255804
Gene Page ID:
ORF Xenbase ID: 17258403

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054201
Original XGC clone length: 906

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: B12

Sequences - 5ʹ (forward) EST

Accession: JZ839379
dbEST ID: 79657081
Trimmed Sequence: ATGTGGACACCAGCTATCATAATCTGCCTATTGGCTCCTCTCTATAAAGCCCATGATACATGTCCAGAAGTGAAAGTTGTGGGTGTCGGTGATTCAGGTACGCTGACCATACTCAGAGGATGTCCAGGAATACCAGGACCTCCAGGTCAAAAAGGAGAATTGGGATCAACAGGAGAGAAAGGAGCCCGTGGAGAGCCGGGAAAATATGGACCTCCAGGTCAGAAAGGTGAAAAGGGAGACAATGGTGATGCTAACTTGGTATATGCTGCCAGAAACTGTAAGGAACTACTAGACCAGGGAGTGGTCCTCAGCGACTGGTACACAATATACCCAGATGGTGTCCATCCCATGAAGGTGCTGTGTGACATGCATACCGACGGAGGAGGCTGGATAGTTTTCCAAAGACGTTGGGATGGCTCTGTGGATTTTTTCCGTGACTGGAAGTCCTATAAATCAGGGTTTGGCAGCAGGCTTAATGACTTTTGGCTGGGGAATGATAATCTTCATAAATTAACCTCATCGGGCTCATGGGAATTGAGGATTGAATTACATGACTTTTAAAAACACAAAGAACTTTGCTAAGTATAAAACCTTCCAGATTCTGGGAGAGTCAAAAAAATTTAATTTTATTATTTGAAACCATGAAGGAAGGGTAAAATAGGGAATTCAAAGAAGTTTTAAAACAAGATCGCCTTTTTCCAGCAAGGATCAAAAAAAAGGAATTAAAGGCGGGAACGTTTGGGGCTAGTAAGATTCAAAGGAAAAGCGTGAGGGGGGGGGGGGGGG
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGACACCAGCTATCATAATCTGCCTATTGGCTCCTCTCTATAAAGCCCATGATACATGTCCAGAAGTGAAAGTTGTGGGTGTCGGTGATTCAGGTACGCTGACCATACTCAGAGGATGTCCAGGAATACCAGGACCTCCAGGTCAAAAAGGAGAATTGGGATCAACAGGAGAGAAAGGAGCCCGTGGAGAGCCGGGAAAATATGGACCTCCAGGTCAGAAAGGTGAAAAGGGAGACAATGGTGATGCTAACTTGGTATATGCTGCCAGAAACTGTAAGGAACTACTAGACCAGGGAGTGGTCCTCAGCGACTGGTACACAATATACCCAGATGGTGTCCATCCCATGAAGGTGCTGTGTGACATGCATACCGACGGAGGAGGCTGGATAGTTTTCCAAAGACGTTGGGATGGCTCTGTGGATTTTTTCCGTGACTGGAAGTCCTATAAATCAGGGTTTGGCAGCAGGCTTAATGACTTTTGGCTGGGGAATGATAATCTTCATAAATTAACCTCATCGGGCTCATGGGAATTGAGGATTGAATTACATGACTTTTAAAAACACAAAGAACTTTGCTAAGTATAAAACCTTCCAGATTCTGGGAGAGTCAAAAAAATTTAATTTTATTATTTGAAACCATGAAGGAAGGGTAAAATAGGGAATTCAAAGAAGTTTTAAAACAAGATCGCCTTTTTCCAGCAAGGATCAAAAAAAAGGAATTAAAGGCGGGAACGTTTGGGGCTAGTAAGATTCAAAGGAAAAGCGTGAGGGGGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGACACCAGCTATCATAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839378
dbEST ID: 79657080
Trimmed Sequence: CAAAGGCCTAATTTTCATTTCCGAATGTTTGTAGGAATAATTGTGCCCTCTGCCATACCAGTTGATCCCCTCTGCTGTGTTGCTGCTGTGACTTCCTAACAGATACAACCCATTGAGGTTTGAATGATGACAACCATTGTACCACCACGCTCCCTTGTATTTAGTAGCACAATGTTCAGACCATAAGTCGTTGTCTTGATCCTTGGTGGAAAATGGCATGGTGTTGTGAACCTTCATAGAATCCCCTATATTACCCTCCTTCATGGCTCCAATTAATAACTTATACTTCTCTGACTCCTCCAGAATCTGGAAGGTTTCATATTTAGCAAAGTGCTTTGTGTTCTCAAAGTCATGCAGATCAATCCTCAATTCCCATGAGCCCGATGAGGTTAATTTATGAAGATTATCATTCCCCAGCCAAAACTCATTAAGCCTGCTGCCAAACCCTGATTTATAGGACTTCCAGTCACGGAAAAAATCCACAGAGCCATCCCAACGTCTTTGGAAAACTATCCAGCCTCCTCCGTCGGTATGCATGTCACACAGCACCTTCATGGGATGGACACCATCTGGGTATATTGTGTACCAGTCGCTGAGGACCACTCCCTGGTCTAGTAGTTTCTTACAGTTCCTGGCAGCATATACCAAGTTACCATCACCATTGTCTCCCTTTTCACCTTTCTGAACTGAAAGGTCCATATTTTTCCCCGCCTTCCC
Full Trace Sequence: GGAGAAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAAGGCCTAATTTTCATTTCCGAATGTTTGTAGGAATAATTGTGCCCTCTGCCATACCAGTTGATCCCCTCTGCTGTGTTGCTGCTGTGACTTCCTAACAGATACAACCCATTGAGGTTTGAATGATGACAACCATTGTACCACCACGCTCCCTTGTATTTAGTAGCACAATGTTCAGACCATAAGTCGTTGTCTTGATCCTTGGTGGAAAATGGCATGGTGTTGTGAACCTTCATAGAATCCCCTATATTACCCTCCTTCATGGCTCCAATTAATAACTTATACTTCTCTGACTCCTCCAGAATCTGGAAGGTTTCATATTTAGCAAAGTGCTTTGTGTTCTCAAAGTCATGCAGATCAATCCTCAATTCCCATGAGCCCGATGAGGTTAATTTATGAAGATTATCATTCCCCAGCCAAAACTCATTAAGCCTGCTGCCAAACCCTGATTTATAGGACTTCCAGTCACGGAAAAAATCCACAGAGCCATCCCAACGTCTTTGGAAAACTATCCAGCCTCCTCCGTCGGTATGCATGTCACACAGCACCTTCATGGGATGGACACCATCTGGGTATATTGTGTACCAGTCGCTGAGGACCACTCCCTGGTCTAGTAGTTTCTTACAGTTCCTGGCAGCATATACCAAGTTACCATCACCATTGTCTCCCTTTTCACCTTTCTGAACTGAAAGGTCCATATTTTTCCCCGCCTTCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAAGGCCTAATTTTCATTTCCGA