ORFeome > MGC64359 ORF1 – XORFeome v1.0

MGC64359 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: unnamed
Gene ID: 5798868
Gene Page ID: 5798854
ORF Xenbase ID: 17258409

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC054202
Original XGC clone length: 1290

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: D04

Sequences - 5ʹ (forward) EST

Accession: JZ839409
dbEST ID: 79657111
Trimmed Sequence: ATGTTCACCCTGTGGCAAATGACGGACCCAGTTGTGGTTCTGTGTGGTTACGACACGGTGAAGGACGCTCTGATCAACCACGCGGAGCAGTTCAGTGATCGCCCGGTGTATCCGGTGGTTGAAAAATACACCAAAGGATTCACATTTATGACTGCCAATGATCACTGGCGGGAGTTCCGGAGATACATCCTGACAACTCTGAGGAACATCGGGATGGGGAAACAGACCTTGGAGGAGAAATGTCTGAAGGAGGCCGAGCAGCTGGTAGAGGCTATGGCTGAGAAGGGAGGAAAACCCTTTAACCCATCCCACCTGCTGGGCTGTGCCGTGTCCAACATCATCGGGGCTGTTCTCTTTGGGCAGCAGTTGGACTACAGAGACAAGAAACTCCTGGACCTCATGACAAACACCAGGAAACATGTCAGCAATATCATGTCCATGAAGCATCAGATCTGCAACATGTTCCCACTGCTGTTAAAGTTGCCCTACCTGAACCAGATCCTGGTCAAAAACAGCCTGTACCTGGTGGCCCATGTGAGGGAGCAGTTGGACTTCCACAAGCAGACTCTGGACACCAGCACCCCCAGGGACTTCATTGACCATTTTCTACTCAAGATAAAAGAGGAGTTTGGGGAAGCAGATTCCCAGTTCCATGAGTTGAGTCTGACGACGTAAATTCTCCGGTCGGCTCGTAGCCGGGATCAACACCACCCCTTCCACCCTTCAGTTTCTGTTTCCCCCCTCTTCGCAAACTTTTCCCCCAAATTCCGGGGAAAAAATACCAAAAAAGAAAATGCAAAAAAAAATAAACGGG
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTCACCCTGTGGCAAATGACGGACCCAGTTGTGGTTCTGTGTGGTTACGACACGGTGAAGGACGCTCTGATCAACCACGCGGAGCAGTTCAGTGATCGCCCGGTGTATCCGGTGGTTGAAAAATACACCAAAGGATTCACATTTATGACTGCCAATGATCACTGGCGGGAGTTCCGGAGATACATCCTGACAACTCTGAGGAACATCGGGATGGGGAAACAGACCTTGGAGGAGAAATGTCTGAAGGAGGCCGAGCAGCTGGTAGAGGCTATGGCTGAGAAGGGAGGAAAACCCTTTAACCCATCCCACCTGCTGGGCTGTGCCGTGTCCAACATCATCGGGGCTGTTCTCTTTGGGCAGCAGTTGGACTACAGAGACAAGAAACTCCTGGACCTCATGACAAACACCAGGAAACATGTCAGCAATATCATGTCCATGAAGCATCAGATCTGCAACATGTTCCCACTGCTGTTAAAGTTGCCCTACCTGAACCAGATCCTGGTCAAAAACAGCCTGTACCTGGTGGCCCATGTGAGGGAGCAGTTGGACTTCCACAAGCAGACTCTGGACACCAGCACCCCCAGGGACTTCATTGACCATTTTCTACTCAAGATAAAAGAGGAGTTTGGGGAAGCAGATTCCCAGTTCCATGAGTTGAGTCTGACGACGTAAATTCTCCGGTCGGCTCGTAGCCGGGATCAACACCACCCCTTCCACCCTTCAGTTTCTGTTTCCCCCCTCTTCGCAAACTTTTCCCCCAAATTCCGGGGAAAAAATACCAAAAAAGAAAATGCAAAAAAAAATAAACGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCACCCTGTGGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839408
dbEST ID: 79657110
Trimmed Sequence: GGTGGGTTGGGAGGAGCGAGGGACAGCGCGGATCTCATAGGATTTGATCATCTCATCCTTATTTAACCTGAGAGATTTCATGTCCATTTGGGCCCCAGAGACTGAAGAGAAGGAGAATTTCTGGAGCAGAGCCGAGAAGAAGAGGAAAATCTCCATCCGAGCCAAATTCACCCCCAGGCACTCGCGCTTCCCTGCAGAAAATGCCATGAAAGCCGGCTTTGCCCGAAACTGTCCCTTCTCATCAAGAAAATGCCCCGGGTTGAATTCATGTGGGGTCTCCCACTGGGTCGGGTCGAAGAGCACTGAGGAGAGGTACGGGATGATCCGGGTGCCCTTGGGGAAGGTGTAGCCATGGAACTTGGTATCTTCTGTTAGCGCATGAAATAACGCTGCTGGGGCCAGATCCAAGTGCCTCTGCAGTTCATGAATCACGGCATTGGTGTAAGGCATCCGGGGTCGGTCACTTATTCCTGGGGGGCGCTGGGACCCCGTTACATCATCGATCTCTTTTTGTACTTTTGCCTGAATGTGGGGCAAGTGTGCGATGAGGGTGACACAGAACTTGAGGGTGGAAGTGGTGGTGTCGATCCCGGCTACGAGCAGACCGGAAATATACGTCGTCAGACTCAACTCAGGGAACCTTGGAATCTGCTTTTCCAAACTCCTCTTTTTACCTTGAATAAAAAATGGGTCATTGAAATTCCCGGGGGGGGTGCCTGGGGGTTCAAAAATTCCTGCCTTTGGGGAAAAATTCCAAACTTG
Full Trace Sequence: GGCGTGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGTGGGTTGGGAGGAGCGAGGGACAGCGCGGATCTCATAGGATTTGATCATCTCATCCTTATTTAACCTGAGAGATTTCATGTCCATTTGGGCCCCAGAGACTGAAGAGAAGGAGAATTTCTGGAGCAGAGCCGAGAAGAAGAGGAAAATCTCCATCCGAGCCAAATTCACCCCCAGGCACTCGCGCTTCCCTGCAGAAAATGCCATGAAAGCCGGCTTTGCCCGAAACTGTCCCTTCTCATCAAGAAAATGCCCCGGGTTGAATTCATGTGGGGTCTCCCACTGGGTCGGGTCGAAGAGCACTGAGGAGAGGTACGGGATGATCCGGGTGCCCTTGGGGAAGGTGTAGCCATGGAACTTGGTATCTTCTGTTAGCGCATGAAATAACGCTGCTGGGGCCAGATCCAAGTGCCTCTGCAGTTCATGAATCACGGCATTGGTGTAAGGCATCCGGGGTCGGTCACTTATTCCTGGGGGGCGCTGGGACCCCGTTACATCATCGATCTCTTTTTGTACTTTTGCCTGAATGTGGGGCAAGTGTGCGATGAGGGTGACACAGAACTTGAGGGTGGAAGTGGTGGTGTCGATCCCGGCTACGAGCAGACCGGAAATATACGTCGTCAGACTCAACTCAGGGAACCTTGGAATCTGCTTTTCCAAACTCCTCTTTTTACCTTGAATAAAAAATGGGTCATTGAAATTCCCGGGGGGGGTGCCTGGGGGTTCAAAAATTCCTGCCTTTGGGGAAAAATTCCAAACTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGTGGGTTGGGAGGAGCGA