ORFeome > MGC64368 ORF1 – XORFeome v1.0

MGC64368 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6255803
Gene Page ID:
ORF Xenbase ID: 17258415

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054206
Original XGC clone length: 993

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ839419
dbEST ID: 79657121
Trimmed Sequence: ATGCCTGGAGACTGGGACTCGGAGTTGGACTCAACATGGGAGGACGAGGAGAAGTGTGCGCCCAGGAGGAAGAGGAGACACGTCTGGGGGTCTCCCAAGGCAGATCTGTGTAACTACCGGCGTGGATATCCGGACAAAGTGGAACCGGGCAGTAAGGAGATGCCAAACCTACAATTCTACCAGAACAAACGCCCCTTTAGACCAGGAGGAGAATACATAGATACATTGCTTAGTGACTGGACGGAAGATTATGTCCGACTGGAAGAGAACCATTCGTATATCCAGTGGCTGTTCCCATTGCGGGAGAAGGGAGTGAATCCTCAAGCTGTACCGCTGACACTACATGAGATTAAGGCAATGAAGGCAGATGACAACGTCAGGAGGAGGTTCTGTGAGGCCTACAGACTTATGTTGGGCTTTTATGGCATAGAATTAAGCAATGAGAAAACTGGGGAAGTTGTCCGGACCACGAAATACTGGGAAAGATTCAACAATCTCAATCGTCACCGGCACAATAACCTGAGGATCACACGGATACTAAAGTGTTTGGGGGAACTTGGCTATGAGCACTTCCCAGCTCCACTCATCCAGTTCTTTCTGGAGGAGAGCCTGGTGAATGGAGAGTTGCCCAATGTCACACGCATTGCTTTGGATTATTTCCTGGTTTACTGTGGAAGGACGGAAAAAAAGCCGCAAGGAATTGGGTGGCGGGTGGCGGGGGAAGCGTGTCCCAGGAGCCAAAGCCACGGGTTTTATAGTGGGGGGCCCAAAAAAAAAGGCCTTCTAACCCCTTTTAAGGGCC
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTGGAGACTGGGACTCGGAGTTGGACTCAACATGGGAGGACGAGGAGAAGTGTGCGCCCAGGAGGAAGAGGAGACACGTCTGGGGGTCTCCCAAGGCAGATCTGTGTAACTACCGGCGTGGATATCCGGACAAAGTGGAACCGGGCAGTAAGGAGATGCCAAACCTACAATTCTACCAGAACAAACGCCCCTTTAGACCAGGAGGAGAATACATAGATACATTGCTTAGTGACTGGACGGAAGATTATGTCCGACTGGAAGAGAACCATTCGTATATCCAGTGGCTGTTCCCATTGCGGGAGAAGGGAGTGAATCCTCAAGCTGTACCGCTGACACTACATGAGATTAAGGCAATGAAGGCAGATGACAACGTCAGGAGGAGGTTCTGTGAGGCCTACAGACTTATGTTGGGCTTTTATGGCATAGAATTAAGCAATGAGAAAACTGGGGAAGTTGTCCGGACCACGAAATACTGGGAAAGATTCAACAATCTCAATCGTCACCGGCACAATAACCTGAGGATCACACGGATACTAAAGTGTTTGGGGGAACTTGGCTATGAGCACTTCCCAGCTCCACTCATCCAGTTCTTTCTGGAGGAGAGCCTGGTGAATGGAGAGTTGCCCAATGTCACACGCATTGCTTTGGATTATTTCCTGGTTTACTGTGGAAGGACGGAAAAAAAGCCGCAAGGAATTGGGTGGCGGGTGGCGGGGGAAGCGTGTCCCAGGAGCCAAAGCCACGGGTTTTATAGTGGGGGGCCCAAAAAAAAAGGCCTTCTAACCCCTTTTAAGGGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTGGAGACTGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839418
dbEST ID: 79657120
Trimmed Sequence: TTTATTTCTGTTGTGCTTTGGTTTGTGTGAATGTGCTTTCTCTCCTGCCATGCACAACAGATCTCTCCAACTTCTTTTTTTATCCTTATGTGCTTTGACCCGTTCACCTCCCTTTTCTGATTCCACCCCATGCTCCCCAGCTCTTTGTCTTCCCAAATTTCCATTACTTACTTTAACCTTATCCATGGAAATGTGATTCTCTGAGCTCCTTGCTGCCCTACAGCTCAAGATATCTCTTGGCCCCCATATAAACCCTGCTTTGTCTGGGAAATGTTTCCAGGCATACAGCACCAACTCCCTGCGCTTCTTTCTGTCCTTCACAGTAAACATGAAATAATCCAAAGCACTGCGTCTGACATTGGGCAACTCCTCATTCACCAGTGTCTCCTCCAGAAAGAACTGGATGAGTGGAGCTTGGAAGTGCTCATAGCCNAGTTCCCCCAAACACTTTAGTATCCGTGTGATCCTCANGTTATTGTGCCGGTGACGATTGAGATTGTTGAATCTTTCCCAGTATTTCGTGGTCCGGGACACTTCCCCATTTTTCTATTGCTTAATTCTATGCCATAAAAGCCCAACATAAGTTTGTAGGCCTCACAGACCCCCCTCCTGACGTTGTCATCTGCCTTTCATTGCTTTAATCTACAGTAAGGGTCAGCGGGTACAGCTTGAAGGGATTCCCCTCCCTTCTCCCCCCAGGTGGGAACAGCCCACGGGGAATTACAAAATGGGTTTCCTTTTCCCAGTTCGAAAAAATTTTTCTCCTTCCCT
Full Trace Sequence: GGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTATTTCTGTTGTGCTTTGGTTTGTGTGAATGTGCTTTCTCTCCTGCCATGCACAACAGATCTCTCCAACTTCTTTTTTTATCCTTATGTGCTTTGACCCGTTCACCTCCCTTTTCTGATTCCACCCCATGCTCCCCAGCTCTTTGTCTTCCCAAATTTCCATTACTTACTTTAACCTTATCCATGGAAATGTGATTCTCTGAGCTCCTTGCTGCCCTACAGCTCAAGATATCTCTTGGCCCCCATATAAACCCTGCTTTGTCTGGGAAATGTTTCCAGGCATACAGCACCAACTCCCTGCGCTTCTTTCTGTCCTTCACAGTAAACATGAAATAATCCAAAGCACTGCGTCTGACATTGGGCAACTCCTCATTCACCAGTGTCTCCTCCAGAAAGAACTGGATGAGTGGAGCTTGGAAGTGCTCATAGCCNAGTTCCCCCAAACACTTTAGTATCCGTGTGATCCTCANGTTATTGTGCCGGTGACGATTGAGATTGTTGAATCTTTCCCAGTATTTCGTGGTCCGGGACACTTCCCCATTTTTCTATTGCTTAATTCTATGCCATAAAAGCCCAACATAAGTTTGTAGGCCTCACAGACCCCCCTCCTGACGTTGTCATCTGCCTTTCATTGCTTTAATCTACAGTAAGGGTCAGCGGGTACAGCTTGAAGGGATTCCCCTCCCTTCTCCCCCCAGGTGGGAACAGCCCACGGGGAATTACAAAATGGGTTTCCTTTTCCCAGTTCGAAAAAATTTTTCTCCTTCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTATTTCTGTTGTGCTTTGGT