ORFeome > MGC64410 ORF1 – XORFeome v1.0

MGC64410 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 5797769
Gene Page ID:
ORF Xenbase ID: 17258439

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056847
Original XGC clone length: 1491

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: G04

Sequences - 5ʹ (forward) EST

Accession: JZ839531
dbEST ID: 79657233
Trimmed Sequence: ATGGAAATCTTCTCTGTCCTGACTTTGTTCTTCATCTTCCTGCTCACCCTCCTCTTCCTCTCCTCACTGTGGAGACAACAGAAGAGATCTCACGTCCTACCCCCAGGCCCAACCCCAATCCCACTTCTAGGCACCCCAAATTATTTATACCGTGATGGAATTCTCAGGTATTACCCAGAGTTCCACAAGAAATACGGCACAATCTTCACCCTGTGGCAAATGACGGACCCAGTTGTGGTTCTGTGTGGTTACGACACGGTGAAGGAGGCTCTGATCAACCACGCGGAGAGGTTCAGTGATCGCCCCCCGTATCCGTTACTTGATAAATACACGGAAGGATTCAATTTTCTAAGTACCAACAAACACTGGCGCCTCTTCCGCAGATTCATACTAATGACACTGAGGAACCTTGGGTTGGGGAAGAGGTCCCTAGAGGAGAAATGTCTCAAGGAGGCTGAGCTGCTTGTTGAGGCTGTGTCTGAGATGGGAGCAAAGCCCTTCAACCCAATCCACATCCTCAGCTTTGCTGTGTCCAACTTCATGAGAACGGTCCTGTTCGGCCAGCGTTTGGATTACAAGGACAAGAAGTTGCTGGAGCTCATTTCCCACATAANGAAGCACTCCGACAATATCTTCTCTGCCAAACACCAGATCTGCAACATGTTTCCTGTTCTGCTTAGTTGCCTTAACTGTGGGAGGTACTCTCAAAAAACAGCCTGTACCTGGTGGCCATGGTGAGGGAGCAGTTGGACTTCCCAAGCAGACTCTGAACACACCGCCCCCCGGGAACTTCCTTGACCTTTTCCACCTGAAAAATAAAAAAAG
Full Trace Sequence: GTTGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAATCTTCTCTGTCCTGACTTTGTTCTTCATCTTCCTGCTCACCCTCCTCTTCCTCTCCTCACTGTGGAGACAACAGAAGAGATCTCACGTCCTACCCCCAGGCCCAACCCCAATCCCACTTCTAGGCACCCCAAATTATTTATACCGTGATGGAATTCTCAGGTATTACCCAGAGTTCCACAAGAAATACGGCACAATCTTCACCCTGTGGCAAATGACGGACCCAGTTGTGGTTCTGTGTGGTTACGACACGGTGAAGGAGGCTCTGATCAACCACGCGGAGAGGTTCAGTGATCGCCCCCCGTATCCGTTACTTGATAAATACACGGAAGGATTCAATTTTCTAAGTACCAACAAACACTGGCGCCTCTTCCGCAGATTCATACTAATGACACTGAGGAACCTTGGGTTGGGGAAGAGGTCCCTAGAGGAGAAATGTCTCAAGGAGGCTGAGCTGCTTGTTGAGGCTGTGTCTGAGATGGGAGCAAAGCCCTTCAACCCAATCCACATCCTCAGCTTTGCTGTGTCCAACTTCATGAGAACGGTCCTGTTCGGCCAGCGTTTGGATTACAAGGACAAGAAGTTGCTGGAGCTCATTTCCCACATAANGAAGCACTCCGACAATATCTTCTCTGCCAAACACCAGATCTGCAACATGTTTCCTGTTCTGCTTAGTTGCCTTAACTGTGGGAGGTACTCTCAAAAAACAGCCTGTACCTGGTGGCCATGGTGAGGGAGCAGTTGGACTTCCCAAGCAGACTCTGAACACACCGCCCCCCGGGAACTTCCTTGACCTTTTCCACCTGAAAAATAAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAATCTTCTCTGTCCTGACT

Sequences - 3ʹ (reverse) EST

Accession: JZ839530
dbEST ID: 79657232
Trimmed Sequence: GGCGGTGTGGGAGGAGCGAGGGACAGCGCGGATCTCCCAGTACTTGATAATGTTTCTCTTGTTTAACCTGAGAGATTTCATGTCCATTTGGGCCCCAGAGACTGAAGAGAAGGAGAATTTCTGGAGCAGAGCCGAGAAGAAGAGGAAAAGCACCATCCGAGCCAAACTCACCCCCAGGCACTCGCGCTTCCCTGCAGAAAATGCCATGAAAGCCGGCTTTGCCCGGAACTGCCCCTTTTCATCCAGAAAATGACCTGGGTTGAACTCATCTGGGGTCTCCCACTGGGTCGGGTCAAACAGGACTGAGGAGAGGTTCGGGATGATCCGGGTGCCCTTGGGCAGAACGTAGCCTTGAAACGTTATATCCTGAGTCACAACACGATAGAACCCAGATGGTGCCAGATCCAAATGCCTCTGTAGTTCATAAATCACAGCATTGGTGTAGGGCATGTGGGACCGGTCACTCATCCCTGGGGGGCGCTGGGACCCAGTAACCTTATCAATCTCTTCTTGTACTTTGGCCTGAATGTCGGGGAGACGAGCAATGACAGCCAGAAAGTACTTGAGAGTGGAAGTGGTGCTGTCGGAACCGGCTGCCCATAAACTGCTAATAAACATGATCCAACTGGTGTCCCGGAAACTGGGAAGGTGCCTTTACCCCCCTCCCCTTTTAATCTCCCATAAGAAAATGGGTCAGGGAATTCCCCTGGGGGGCCCCTGGGTGTCCCCAAAATCCCGCCTTTTGTGGGAAGTCTCCACCCGCC
Full Trace Sequence: GGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCGGTGTGGGAGGAGCGAGGGACAGCGCGGATCTCCCAGTACTTGATAATGTTTCTCTTGTTTAACCTGAGAGATTTCATGTCCATTTGGGCCCCAGAGACTGAAGAGAAGGAGAATTTCTGGAGCAGAGCCGAGAAGAAGAGGAAAAGCACCATCCGAGCCAAACTCACCCCCAGGCACTCGCGCTTCCCTGCAGAAAATGCCATGAAAGCCGGCTTTGCCCGGAACTGCCCCTTTTCATCCAGAAAATGACCTGGGTTGAACTCATCTGGGGTCTCCCACTGGGTCGGGTCAAACAGGACTGAGGAGAGGTTCGGGATGATCCGGGTGCCCTTGGGCAGAACGTAGCCTTGAAACGTTATATCCTGAGTCACAACACGATAGAACCCAGATGGTGCCAGATCCAAATGCCTCTGTAGTTCATAAATCACAGCATTGGTGTAGGGCATGTGGGACCGGTCACTCATCCCTGGGGGGCGCTGGGACCCAGTAACCTTATCAATCTCTTCTTGTACTTTGGCCTGAATGTCGGGGAGACGAGCAATGACAGCCAGAAAGTACTTGAGAGTGGAAGTGGTGCTGTCGGAACCGGCTGCCCATAAACTGCTAATAAACATGATCCAACTGGTGTCCCGGAAACTGGGAAGGTGCCTTTACCCCCCTCCCCTTTTAATCTCCCATAAGAAAATGGGTCAGGGAATTCCCCTGGGGGGCCCCTGGGTGTCCCCAAAATCCCGCCTTTTGTGGGAAGTCTCCACCCGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCGGTGTGGGAGGAGC