ORFeome > MGC64431 ORF1 – XORFeome v1.0

MGC64431 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6255817
Gene Page ID:
ORF Xenbase ID: 17258451

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC053799
Original XGC clone length: 963

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: A04

Sequences - 5ʹ (forward) EST

Accession: JZ839319
dbEST ID: 79657021
Trimmed Sequence: ATGATTCTGAACTTGCATCCCCTGGAGAACCTGAAGTCCTACATCAGCAGCCGGCCACCTCTGGTGATTTTTATGGTCAGTGTAAGTGGAATGGCCATAGCCTTCCTTACACTTGGTTATTTCTTCAAAATGAAAGAGATCAAGTCACCGGGGATGACTGAGGACTGGAACATCTTCCTCCTGAGGTTTAACAATCTGGACTTGTGTGTATCTGAAAATGAAACCTTAAAGCATTTTTTGAATGAAACCACCCCTCCTGAGAGTACAGTAACTTCAGGTCAAGCGAGGTCATCCACACAAACCCCTCAAGCTCTAGAAGACTCTGGACCCATAAATATTTCTGTGGCAATTACCTTGACTTTAGATCCACTAAAACCCTTTGGAGGATATTCACGTAACATCACTCACCTGAGCTCAACCATTTTTGGCCATCAGATTGGTCTTTCAGGCAGAGATTCCCACGAGGAGATGAATATTACGTTCACTTTGCCTGCTGCGTGGAACTCTGATGACTGTATTGTCCATGGGCACTGTGAACAGGTGGTGTTTACTACATGCATGACTGTCACCGCAGTGACCAATGTGTTTCCAGTCACAGTTCAGCCTCCTCACTGTATTCCTGAGACATACAGCAATGCTTCGTTGTGGTACAAGATCTACACCACTGCTCGTGACTCAGGGACAAAGAACGCACAAGACTATTATCCCTTCTGGGTGTTCAAAGGAGCAATTTGGCAAGGTGTACCATGCTTTTAAATCCCAAACTCACCGTAATTGGTCCCCAAAAGGTAAGTGCCCCCCCCTGAAACCCTTTTAATGT
Full Trace Sequence: CGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTCTGAACTTGCATCCCCTGGAGAACCTGAAGTCCTACATCAGCAGCCGGCCACCTCTGGTGATTTTTATGGTCAGTGTAAGTGGAATGGCCATAGCCTTCCTTACACTTGGTTATTTCTTCAAAATGAAAGAGATCAAGTCACCGGGGATGACTGAGGACTGGAACATCTTCCTCCTGAGGTTTAACAATCTGGACTTGTGTGTATCTGAAAATGAAACCTTAAAGCATTTTTTGAATGAAACCACCCCTCCTGAGAGTACAGTAACTTCAGGTCAAGCGAGGTCATCCACACAAACCCCTCAAGCTCTAGAAGACTCTGGACCCATAAATATTTCTGTGGCAATTACCTTGACTTTAGATCCACTAAAACCCTTTGGAGGATATTCACGTAACATCACTCACCTGAGCTCAACCATTTTTGGCCATCAGATTGGTCTTTCAGGCAGAGATTCCCACGAGGAGATGAATATTACGTTCACTTTGCCTGCTGCGTGGAACTCTGATGACTGTATTGTCCATGGGCACTGTGAACAGGTGGTGTTTACTACATGCATGACTGTCACCGCAGTGACCAATGTGTTTCCAGTCACAGTTCAGCCTCCTCACTGTATTCCTGAGACATACAGCAATGCTTCGTTGTGGTACAAGATCTACACCACTGCTCGTGACTCAGGGACAAAGAACGCACAAGACTATTATCCCTTCTGGGTGTTCAAAGGAGCAATTTGGCAAGGTGTACCATGCTTTTAAATCCCAAACTCACCGTAATTGGTCCCCAAAAGGTAAGTGCCCCCCCCTGAAACCCTTTTAATGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTCTGAACTTGCATCCCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839318
dbEST ID: 79657020
Trimmed Sequence: AGGAAAAATACTCACATAAGATAAAAATACACAACTGTGTTCTACAATGTTTGTTAGATGCTGAAAATAAAAAAAAAAGGAAAGTGGGTCTTGTTTATAAATTGCCACAATGTATGCTATGCATTCAGGGAAATTCACCAAGTTATTAACATGTAAAGGCTCAGTGTGTGCACTCACCTCTGGGACAATTACGGTGAGTTTGGGATTTAAAGCATGGTACACCTTGCCAATTGCTCCTTTGTAACACCAAAAGGGATTATAGTCTTGTGCGTTCTTTGTCCCTGAGTCACGAGCAGTGGTGTAAATCTTGTACCACAACGAAGCATTGCTGTATGTCTCAGGAATACAGTGAGGAGGCTGAACTGTGACTGGAAACACATTGGTCACTGCGGTGACAGTCATGCATGTAGTAAACACCACCTGTTCACAGTGCCCATGGACAATACAGTCATCAAAGTTCCACGCAGCAGGCAAAGTGAACGTAATATTCATCTCCTCGTGGGAATCTCTGCCTGAAAGACCAATCTGATGGCCAAAAATGGTTGAGCTCAGGTGAGTGATGTTACTTGAATATCCTCCAAAGGGTTTTTAGTGGATCTAAGGTCAAGGTAATTTGCCACAAAATATTTTATGGGTTCCCAAGTCCTCTAGAACTTTAAGGGTTTTTGGTGTGGATGACCCTCCTTTGACCTGAAATTACTGAACCCTCAAAAGAAGGGGTGGTTTCCCTTTCAAAAAAAGCCTTTTAAGGTTTTTCATTTTTCTAAATAAAACCACAAAATTCCCAAA
Full Trace Sequence: GGTGCAACANNGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGGAAAAATACTCACATAAGATAAAAATACACAACTGTGTTCTACAATGTTTGTTAGATGCTGAAAATAAAAAAAAAAGGAAAGTGGGTCTTGTTTATAAATTGCCACAATGTATGCTATGCATTCAGGGAAATTCACCAAGTTATTAACATGTAAAGGCTCAGTGTGTGCACTCACCTCTGGGACAATTACGGTGAGTTTGGGATTTAAAGCATGGTACACCTTGCCAATTGCTCCTTTGTAACACCAAAAGGGATTATAGTCTTGTGCGTTCTTTGTCCCTGAGTCACGAGCAGTGGTGTAAATCTTGTACCACAACGAAGCATTGCTGTATGTCTCAGGAATACAGTGAGGAGGCTGAACTGTGACTGGAAACACATTGGTCACTGCGGTGACAGTCATGCATGTAGTAAACACCACCTGTTCACAGTGCCCATGGACAATACAGTCATCAAAGTTCCACGCAGCAGGCAAAGTGAACGTAATATTCATCTCCTCGTGGGAATCTCTGCCTGAAAGACCAATCTGATGGCCAAAAATGGTTGAGCTCAGGTGAGTGATGTTACTTGAATATCCTCCAAAGGGTTTTTAGTGGATCTAAGGTCAAGGTAATTTGCCACAAAATATTTTATGGGTTCCCAAGTCCTCTAGAACTTTAAGGGTTTTTGGTGTGGATGACCCTCCTTTGACCTGAAATTACTGAACCCTCAAAAGAAGGGGTGGTTTCCCTTTCAAAAAAAGCCTTTTAAGGTTTTTCATTTTTCTAAATAAAACCACAAAATTCCCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGAAAAATACTCACATAAGATAA