ORFeome > MGC64444 ORF1 – XORFeome v1.0

MGC64444 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: unnamed
Gene ID: 5857153
Gene Page ID: 5857145
ORF Xenbase ID: 17258457

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053801
Original XGC clone length: 930

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ839505
dbEST ID: 79657207
Trimmed Sequence: ATGGCAGACTCCACATTGGTTGATCACATGACTAGACTGAAACTGAAACTTCTGGAGAAGAGATTAGAGAACGAACGTGAAATGGCAGAGGAAGCTGGTGAAACTGAGCCTGAAACTGCAAGAAGCTACAATGGACATGAAGAAGCTCTGCAGTCAGCTTTACGAAGGAGGAAGGGTCTACTGCATAAATTACGTGAAGAGCATCTTCTAGAAGAAATTGCTCGGCCTCACACGTGGGAGGGCACACACCGAAAAAAAAATTATGTGGAACCCATTCATCAGATATCACCAATGCACTTCCATCACCAACTACCTCCTCGAGAGCCACCCATACACTTTTATCCACCTCCACCTCCACAAGAGCCACCCAGAATCATCCAGCAGCAGCTACCTCAGCCTCCAGCAACCATAATCCAGCAATTACCACCACAGCAGCCCCTTATTACTCAGATACCCCATCCTCAATCACTACAGCCTGTCCGCTCTGGCAGCATTAAGGAAGATATGGTTGAAATGATGCTTATGCAGAATGCTCAGATGCATCAGATTATTATGCAAAACATGATGTTAAAAGCACTTCCTCCAATGGCTCTGTCACAACCTGCAGGTGGTGTACCCTCAACACACACCTCAGCACTCCAGGACCCTAAATATGCTGGTCCTGGTGGTCCTGAGAGCTGAAAAAATGCGACCCATCCTCTGTGCACCATCATCCCCACTACACCCCACCCTAACCTTCCTGGGTGGGGCTCTTTCCCGTGCACCCGGGACCGGGAAAATCCCTTGGGGGGCCCCCCTGGGAGCCCTTCCAACCCCCTATGGGGGACCGAA
Full Trace Sequence: GTGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGACTCCACATTGGTTGATCACATGACTAGACTGAAACTGAAACTTCTGGAGAAGAGATTAGAGAACGAACGTGAAATGGCAGAGGAAGCTGGTGAAACTGAGCCTGAAACTGCAAGAAGCTACAATGGACATGAAGAAGCTCTGCAGTCAGCTTTACGAAGGAGGAAGGGTCTACTGCATAAATTACGTGAAGAGCATCTTCTAGAAGAAATTGCTCGGCCTCACACGTGGGAGGGCACACACCGAAAAAAAAATTATGTGGAACCCATTCATCAGATATCACCAATGCACTTCCATCACCAACTACCTCCTCGAGAGCCACCCATACACTTTTATCCACCTCCACCTCCACAAGAGCCACCCAGAATCATCCAGCAGCAGCTACCTCAGCCTCCAGCAACCATAATCCAGCAATTACCACCACAGCAGCCCCTTATTACTCAGATACCCCATCCTCAATCACTACAGCCTGTCCGCTCTGGCAGCATTAAGGAAGATATGGTTGAAATGATGCTTATGCAGAATGCTCAGATGCATCAGATTATTATGCAAAACATGATGTTAAAAGCACTTCCTCCAATGGCTCTGTCACAACCTGCAGGTGGTGTACCCTCAACACACACCTCAGCACTCCAGGACCCTAAATATGCTGGTCCTGGTGGTCCTGAGAGCTGAAAAAATGCGACCCATCCTCTGTGCACCATCATCCCCACTACACCCCACCCTAACCTTCCTGGGTGGGGCTCTTTCCCGTGCACCCGGGACCGGGAAAATCCCTTGGGGGGCCCCCCTGGGAGCCCTTCCAACCCCCTATGGGGGACCGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGACTCCACATTGGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839504
dbEST ID: 79657206
Trimmed Sequence: CAGGCCGCTCGGGACTCTGGGGAGGAATCCATCTGTCACTACAGTCTGCATGGCTGGCAGGATGGTAGTTGGGCCAGTAACATGATGGACAGCAGGAGGAAATGAATTCATGTGCCCCATAGTGTTTGATGGCATCATGTGGGGCCACAATGGATATCCAGGTCCTGGCTGCATGGGAAGAGGCCCACCAGGAATGCTAGGTGGGGTGTAGNTGGTGATGATGGTGCACAGAGGATGGTCGCATTTTTTCAGCTCTCAGGACCACAGGACCAGCATTATTAGGGTCCTGGAGTGCTGAGGTGTGTGTTGAGGGTACACCACCTGCAGGTTGTGACAGAGCCATTGGAGGAAGTGCTTTTAACATCATGTTCTGCATAATAATCTGATGCATTTGAACATTCTGCATAAGCATCATTTCAACCATATCTTCCTTAATGCTGCCGGAGCGGACAGGCTGTAGTGATTGAGGATGGCGTATCTGACTACTAAAGGGGTGCTGTAGATGGTATTGCTAGATTATGGTTCCTGCAGGCTGGGGGGGGTGCTGCTCCCACAGTGGGGGGGGCTCCTGTGCAGTCGGGGGTGGGTGCAGGGGCGAAAATAGGTGGTGGGGGGGGTGTAAGATAAAAAAAAAATATAAGTGGGGGGGCGGGGGGCTGGGGGGGAGGGGGGGTGCCCTAAAAAAGTGGGGGTGGTGGGGGGTGGAGCGACCCCCCCCCCCCAAAGAAAAGAGGGAGAGACCCGCCCCGGGGGAAAG
Full Trace Sequence: GAAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGGCCGCTCGGGACTCTGGGGAGGAATCCATCTGTCACTACAGTCTGCATGGCTGGCAGGATGGTAGTTGGGCCAGTAACATGATGGACAGCAGGAGGAAATGAATTCATGTGCCCCATAGTGTTTGATGGCATCATGTGGGGCCACAATGGATATCCAGGTCCTGGCTGCATGGGAAGAGGCCCACCAGGAATGCTAGGTGGGGTGTAGNTGGTGATGATGGTGCACAGAGGATGGTCGCATTTTTTCAGCTCTCAGGACCACAGGACCAGCATTATTAGGGTCCTGGAGTGCTGAGGTGTGTGTTGAGGGTACACCACCTGCAGGTTGTGACAGAGCCATTGGAGGAAGTGCTTTTAACATCATGTTCTGCATAATAATCTGATGCATTTGAACATTCTGCATAAGCATCATTTCAACCATATCTTCCTTAATGCTGCCGGAGCGGACAGGCTGTAGTGATTGAGGATGGCGTATCTGACTACTAAAGGGGTGCTGTAGATGGTATTGCTAGATTATGGTTCCTGCAGGCTGGGGGGGGTGCTGCTCCCACAGTGGGGGGGGCTCCTGTGCAGTCGGGGGTGGGTGCAGGGGCGAAAATAGGTGGTGGGGGGGGTGTAAGATAAAAAAAAAATATAAGTGGGGGGGCGGGGGGCTGGGGGGGAGGGGGGGTGCCCTAAAAAAGTGGGGGTGGTGGGGGGTGGAGCGACCCCCCCCCCCCAAAGAAAAGAGGGAGAGACCCGCCCCGGGGGAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGCCGCTCGGGACTC