ORFeome > MGC64462 ORF1 – XORFeome v1.0

MGC64462 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6255797
Gene Page ID:
ORF Xenbase ID: 17258475

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC054251
Original XGC clone length: 1038

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: F08

Sequences - 5ʹ (forward) EST

Accession: JZ839445
dbEST ID: 79657147
Trimmed Sequence: ATGACGGCCTGTTTCCTACAGGCGGGTTTCGCATTTAAAATCGCCTCCTTCAATATACAGAGATTTAGCATGACGAAAGTGGATGATCCAGTTGTGTTAGAACTCTTGATCCGGATCCTGAGCAGATACGAAATTATTGCCATTGAGGAGGTGATGAATGCAGATAACACCGCGATTATCAGTCTTGTCAAGGAACTCAGCTTAGCTACCAAACTGAACTACAATGTGCTGATTTCAGATCATCTGGGCCGCAGTTCTTACCGTGAGAAGTACGCCTATGTGTACAGGGAAGATATTGTAAAGCCTACCGAGTGGTATCACTTTGATGATGGCTGTGAGAACTGCGGTACAGACAGCTTCATACGGGAACCCTTTGTGGCTCGCTTCACTTCACTCACTACCGTGGTGAAGGACTTTGCCCTGATCTCCATTCACACAAGTCCAGATTATGCTATCATGGAGGTGGACGCCCTATATGATGCGTGGGTAGATGCCAAGCAACGGCTGAAGATGGAGAATATCCTGATTTTAGGAGACTACAATGCTGCCTGCAGTTATGTTGCCAGCAGACACTGGCCAATAATCCGTCTTCGTCATGTTGAAGAATTAGTCTGGCTTATTGGGGATAAAGAGGACACCACTGTGAGCACAAACACCAACTGCGCATATGACAGGATGGTTGCCGGGTGGGGGAGGAGTTGCAAAAGAGGCATTTGTCCCAGACACGGCCAAAAGCCTTCAACTACCATGGTGGCATATGAAACTGGACTTAATAAAAATGGCCCAAACCAATTGTCCTGACCCCCTA
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACGGCCTGTTTCCTACAGGCGGGTTTCGCATTTAAAATCGCCTCCTTCAATATACAGAGATTTAGCATGACGAAAGTGGATGATCCAGTTGTGTTAGAACTCTTGATCCGGATCCTGAGCAGATACGAAATTATTGCCATTGAGGAGGTGATGAATGCAGATAACACCGCGATTATCAGTCTTGTCAAGGAACTCAGCTTAGCTACCAAACTGAACTACAATGTGCTGATTTCAGATCATCTGGGCCGCAGTTCTTACCGTGAGAAGTACGCCTATGTGTACAGGGAAGATATTGTAAAGCCTACCGAGTGGTATCACTTTGATGATGGCTGTGAGAACTGCGGTACAGACAGCTTCATACGGGAACCCTTTGTGGCTCGCTTCACTTCACTCACTACCGTGGTGAAGGACTTTGCCCTGATCTCCATTCACACAAGTCCAGATTATGCTATCATGGAGGTGGACGCCCTATATGATGCGTGGGTAGATGCCAAGCAACGGCTGAAGATGGAGAATATCCTGATTTTAGGAGACTACAATGCTGCCTGCAGTTATGTTGCCAGCAGACACTGGCCAATAATCCGTCTTCGTCATGTTGAAGAATTAGTCTGGCTTATTGGGGATAAAGAGGACACCACTGTGAGCACAAACACCAACTGCGCATATGACAGGATGGTTGCCGGGTGGGGGAGGAGTTGCAAAAGAGGCATTTGTCCCAGACACGGCCAAAAGCCTTCAACTACCATGGTGGCATATGAAACTGGACTTAATAAAAATGGCCCAAACCAATTGTCCTGACCCCCTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACGGCCTGTTTCCTA

Sequences - 3ʹ (reverse) EST

Accession: JZ839444
dbEST ID: 79657146
Trimmed Sequence: TAATTTACAGTAACCAACATAGTCATCACAGCAGTTAACGTAGTCGGCACAGGCAGCATTACAGTTACAGGGGAAGGATTTCGAATAGGCCCCGCAGCGCCCAAGACAGGTTGTAAAATCCACCCCTTCACAGGTACATGGACCGTTGAGAGAGAGGCCACCATCTATCCCAATGCTGCCCCTGGGTTCAAAACGTTGGCCATTGTAGAAAACATCATCGTACAACTCCACTTCGACAGGGTAGTGGTCAGACACTGCTTTGGCCATCTCATAAGTCAGGTCATATGCCACATGGTAGTTGAAGGCTTTGGCCGTGTCTGGGACAATGCCTCTCTGCAACTCTTCCCCACCGGCAACCATCCTGTCATATGCGCAGTTGGTGTTTGTGCTCACAGTGGTGTCCTCTTTATCCCCAATAAGCCAGACTAATTCTTCAACATGACGAAGACGGATTATTGGCCAGTGTCTGCTGGCAACATAACTGCAGGCAGCATTGTAGTCTCCTAAAATCAGGATATTCCTCATCTTCAGCCGTTGCTTGGCATCTACCCACGCCACAAAAAGGGCGTCAACTTCCCTGATAACATAATCTGGGACTTGGGGTGAAGGGAGATCAGGGCCAAAGTCCTTCACCACGGTTAGTAAGTGAAGTGAAACCAAGCCCAAAAAGGGGTTCCCCGAAAGAAAGCCTGTCTGGTACCCGCAAATTCTCTTAAAGGCCCTTCTCACAAAAAGGTGGAAACCCCACC
Full Trace Sequence: CGGGAAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAATTTACAGTAACCAACATAGTCATCACAGCAGTTAACGTAGTCGGCACAGGCAGCATTACAGTTACAGGGGAAGGATTTCGAATAGGCCCCGCAGCGCCCAAGACAGGTTGTAAAATCCACCCCTTCACAGGTACATGGACCGTTGAGAGAGAGGCCACCATCTATCCCAATGCTGCCCCTGGGTTCAAAACGTTGGCCATTGTAGAAAACATCATCGTACAACTCCACTTCGACAGGGTAGTGGTCAGACACTGCTTTGGCCATCTCATAAGTCAGGTCATATGCCACATGGTAGTTGAAGGCTTTGGCCGTGTCTGGGACAATGCCTCTCTGCAACTCTTCCCCACCGGCAACCATCCTGTCATATGCGCAGTTGGTGTTTGTGCTCACAGTGGTGTCCTCTTTATCCCCAATAAGCCAGACTAATTCTTCAACATGACGAAGACGGATTATTGGCCAGTGTCTGCTGGCAACATAACTGCAGGCAGCATTGTAGTCTCCTAAAATCAGGATATTCCTCATCTTCAGCCGTTGCTTGGCATCTACCCACGCCACAAAAAGGGCGTCAACTTCCCTGATAACATAATCTGGGACTTGGGGTGAAGGGAGATCAGGGCCAAAGTCCTTCACCACGGTTAGTAAGTGAAGTGAAACCAAGCCCAAAAAGGGGTTCCCCGAAAGAAAGCCTGTCTGGTACCCGCAAATTCTCTTAAAGGCCCTTCTCACAAAAAGGTGGAAACCCCACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAATTTACAGTAACCAACATAG