ORFeome > MGC64482 ORF3 – XORFeome v1.0

MGC64482 ORF3 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6255795
Gene Page ID:
ORF Xenbase ID: 17258499

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106622
Original XGC clone length: 1095

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: C11

Sequences - 5ʹ (forward) EST

Accession: JZ837748
dbEST ID: 79655450
Trimmed Sequence: ATGCCTCACCAATACCCAGCACTGACCCCCGAGCAGAAGAAGGAGCTCCATGACATCGCCAAACGCATTGTGGCTACTGGCAAGGGCATCCTGGCAGCCGATGAGTCCACAGGCAGCATTGCTAAGCGCTTGAGTTCCATTGGGGCAGAGAACACAGAGGAGAACCGCAGATTTTACCGCCAGTTGCTCTTCACGGCCGACGAAAAAGTGAACCCCTGCATCGGGGGCGTCATCACCTTCCATGAGACCCTCTACCACAAGACCGACGATGGCGTGGCCTTCACCAAAGTCATCAAGGACAAAGGGGGTGTCGTAGGCATTAAGGTTGATAAAGGTGTCGTCCCTCTGGCTGGAACCAACGGTGAAACCACAACTCAAGGTCTGGATGGACTGTCCGAACGCTGTGCCCAGTACAAGAAAGATGGCGCTGACTTTGCCAAGTGGCGCTCCGTGCTCAAGATCTCTGAACACACCCCCTCTCACCTGGCCATCATAGAGAATGCCAACGTATTGGCCCGTTACGCCAGCATCTGCCAACAGAATGGAATTGTGCCCATTGTGGAGCCTGAGGTCCTTCCTGATGGAGAACATGACCTGAAGAGGTGCCAGTATGTGACAGAGAAGGTCCTGGCTGCAGTCTACAAGGCTCTCAGCGACCATCACGTTTACCTGGAAGGGACCCTGGTTAAAACCAAACATGGTTA
Full Trace Sequence: CGAGGGCCCAAATAAGTGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTCACCAATACCCAGCACTGACCCCCGAGCAGAAGAAGGAGCTCCATGACATCGCCAAACGCATTGTGGCTACTGGCAAGGGCATCCTGGCAGCCGATGAGTCCACAGGCAGCATTGCTAAGCGCTTGAGTTCCATTGGGGCAGAGAACACAGAGGAGAACCGCAGATTTTACCGCCAGTTGCTCTTCACGGCCGACGAAAAAGTGAACCCCTGCATCGGGGGCGTCATCACCTTCCATGAGACCCTCTACCACAAGACCGACGATGGCGTGGCCTTCACCAAAGTCATCAAGGACAAAGGGGGTGTCGTAGGCATTAAGGTTGATAAAGGTGTCGTCCCTCTGGCTGGAACCAACGGTGAAACCACAACTCAAGGTCTGGATGGACTGTCCGAACGCTGTGCCCAGTACAAGAAAGATGGCGCTGACTTTGCCAAGTGGCGCTCCGTGCTCAAGATCTCTGAACACACCCCCTCTCACCTGGCCATCATAGAGAATGCCAACGTATTGGCCCGTTACGCCAGCATCTGCCAACAGAATGGAATTGTGCCCATTGTGGAGCCTGAGGTCCTTCCTGATGGAGAACATGACCTGAAGAGGTGCCAGTATGTGACAGAGAAGGTCCTGGCTGCAGTCTACAAGGCTCTCAGCGACCATCACGTTTACCTGGAAGGGACCCTGGTTAAAACCAAACATGGTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTCACCAATACCCAGCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837747
dbEST ID: 79655449
Trimmed Sequence: GTAGGCATGGTTTGATACGAAGAGGGATTCTCCGGCAGCGGCTCCTGTGTCTCCGCTGGCTACATATTTGCCTTGGCACGCCAGGCTGTTTGCCAGGGCGCGCTTGACGTACTCATCCTGAGCCTTCTTGGTGTTCTCCTTCTTGCCCCCCCAAGCTTTGAGGGCAGAGGCCTGAAGGGCACGTCCATAGGAGAAGGTCAGGGGCCAGGGTTTGAGCAGGGGGCACTGGTTGATGGCATTCAGGTGCACCGTGGCCTCTTCCTCACTTTGTCCTCCAGACAGGAAGGTGATTCCTGCAACAGCAGGGGGCACTGTGCGCCTGAGGGCGGTGACTGTTGCCATGGCAATCTCCTGAGGGGGGTACTTCTTGGTGCAGGCGTGCCCGGGGGTAACCATGTTTGGTTTCAACAGGGTCCCTTCCAGGTAAACGTGATGGTCGCTGAGAGCCTTGTAGACTGCAGCCAGGACCTTCTCTGTCACATACTGGCACCTCTTCAGGTCATGTTCTCCATCAGGAAGGACCTCAGGCTCCACAATGGGCACAATTCCATTCTGTTGGCAGATGCTGGCGTAACGGGCCAATACGTTGGCATTCTCTATGATGGCCAGGTGAGAGGGGGTGTGTTCAGAGATCTTGAGCACGGAGCGCCACTTTGCAAAGTCAGCGCCCTCTTTCTTGTACTGGGCAGAGCGTTCGGACAGTCCCTCCAGACCTTGAGTTGTGGGTTTCCCGTTTGTTTCCGCCAGAGGGAACAACCCTTTTTTCACCTTAATGGCCACGACACCCCCTTTGTCCTTGATGAATTTTGGTGAAGGCCACCCCGTCCTCCGTCCTGTGGGAGAAGGTGCTCTGGGAGGTAGAGGACGCCCCCAACCCCGCGGTTCACTTTTTTCTTCTTGCGTGAAAAGGAACCTACCGTAAAAACTGCGGGTCTCCGTCGGTTTTCCTCTCCCCCCCACAAAACTCAAACCCCTAACCAATGGTGCCCTTTGAGACCCATCGGCGTCCGAGGAGGCCCGTTGGCGGTGAAGCCCCAAGTGGTT
Full Trace Sequence: GGGCGTGAAACAGCTTATGACCATGGTAATACGACTCACTATTAGGGGATATCAGCTTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAGGCATGGTTTGATACGAAGAGGGATTCTCCGGCAGCGGCTCCTGTGTCTCCGCTGGCTACATATTTGCCTTGGCACGCCAGGCTGTTTGCCAGGGCGCGCTTGACGTACTCATCCTGAGCCTTCTTGGTGTTCTCCTTCTTGCCCCCCCAAGCTTTGAGGGCAGAGGCCTGAAGGGCACGTCCATAGGAGAAGGTCAGGGGCCAGGGTTTGAGCAGGGGGCACTGGTTGATGGCATTCAGGTGCACCGTGGCCTCTTCCTCACTTTGTCCTCCAGACAGGAAGGTGATTCCTGCAACAGCAGGGGGCACTGTGCGCCTGAGGGCGGTGACTGTTGCCATGGCAATCTCCTGAGGGGGGTACTTCTTGGTGCAGGCGTGCCCGGGGGTAACCATGTTTGGTTTCAACAGGGTCCCTTCCAGGTAAACGTGATGGTCGCTGAGAGCCTTGTAGACTGCAGCCAGGACCTTCTCTGTCACATACTGGCACCTCTTCAGGTCATGTTCTCCATCAGGAAGGACCTCAGGCTCCACAATGGGCACAATTCCATTCTGTTGGCAGATGCTGGCGTAACGGGCCAATACGTTGGCATTCTCTATGATGGCCAGGTGAGAGGGGGTGTGTTCAGAGATCTTGAGCACGGAGCGCCACTTTGCAAAGTCAGCGCCCTCTTTCTTGTACTGGGCAGAGCGTTCGGACAGTCCCTCCAGACCTTGAGTTGTGGGTTTCCCGTTTGTTTCCGCCAGAGGGAACAACCCTTTTTTCACCTTAATGGCCACGACACCCCCTTTGTCCTTGATGAATTTTGGTGAAGGCCACCCCGTCCTCCGTCCTGTGGGAGAAGGTGCTCTGGGAGGTAGAGGACGCCCCCAACCCCGCGGTTCACTTTTTTCTTCTTGCGTGAAAAGGAACCTACCGTAAAAACTGCGGGTCTCCGTCGGTTTTCCTCTCCCCCCCACAAAACTCAAACCCCTAACCAATGGTGCCCTTTGAGACCCATCGGCGTCCGAGGAGGCCCGTTGGCGGTGAAGCCCCAAGTGGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAGGCATGGTTTGATACGA