ORFeome > MGC64513 ORF1 – XORFeome v1.0

MGC64513 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: unnamed
Gene ID: 5829358
Gene Page ID: 5829340
ORF Xenbase ID: 17258511

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053817
Original XGC clone length: 483

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: G04

Sequences - 5ʹ (forward) EST

Accession: JZ839297
dbEST ID: 79656999
Trimmed Sequence: ATGGCTTCTTGGTTTCCACTGCTGCTGCTTCCCGGTGCTCTGGCCGTTAGTAATGTGCTGGAAGCTGCACAGGTCCGCTCTTCTTGCCCCAATGGATGGTTTTTTTACAAGGCAAATTGTTATGGGTATTTCCGCTACCCCCTGAGCTGGGCTGAGGCTGAGTACGACTGCCAGGCATACGGACATGGGGCTCACTTGGCCTCAATATTGGACTCTGCAGAGGCAGACGTCATTGCTTCCCATATCTCTGCCTACCAGAAGAACAAACCAGTGTGGATTGGTCTCCATGACCCTGAGCAGAATCGTCGCTGGAAGTGGAATGATGGCTCCATGTACAATTACCGCTCGTGGCTCGCTGGGCAGCCGGACAACTACAATTCAGCTGAGTACTGTGGGGAACTGTCCTGCAAGGAGGGCTTTGTGAAGTGGAATGACAGTAACTGCAAGGAAGTCAAGCAGTACGTGTGCAAGTACAAGCCTTT
Full Trace Sequence: TCGAGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTCTTGGTTTCCACTGCTGCTGCTTCCCGGTGCTCTGGCCGTTAGTAATGTGCTGGAAGCTGCACAGGTCCGCTCTTCTTGCCCCAATGGATGGTTTTTTTACAAGGCAAATTGTTATGGGTATTTCCGCTACCCCCTGAGCTGGGCTGAGGCTGAGTACGACTGCCAGGCATACGGACATGGGGCTCACTTGGCCTCAATATTGGACTCTGCAGAGGCAGACGTCATTGCTTCCCATATCTCTGCCTACCAGAAGAACAAACCAGTGTGGATTGGTCTCCATGACCCTGAGCAGAATCGTCGCTGGAAGTGGAATGATGGCTCCATGTACAATTACCGCTCGTGGCTCGCTGGGCAGCCGGACAACTACAATTCAGCTGAGTACTGTGGGGAACTGTCCTGCAAGGAGGGCTTTGTGAAGTGGAATGACAGTAACTGCAAGGAAGTCAAGCAGTACGTGTGCAAGTACAAGCCTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAACCTGTTTCCAAAAAAAAAAAAACACAAGTCTCAAACATACAAAAAGTTAAAATAAAAAAACCCAAAAAAAAAAAGTGCCTCTCTTTCAACACCCCGCCTTTTTTTTGTTTGGAGAATCTTTGTGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAATAAAAAATAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTCTTGGTTTCCACT

Sequences - 3ʹ (reverse) EST

Accession: JZ839296
dbEST ID: 79656998
Trimmed Sequence: AGGCTTGTACTTGCACACGTACTGCTTGACTTCCTTGCAGTTACTGTCATTCCACTTCACAAAGCCCTCCTTGCAGGACAGTTCCCCACAGTACTCAGCTGAATTGTAGTTGTCCGGCTGCCCAGCGAGCCACGAGCGGTAATTGTACATGGAGCCATCATTCCACTTCCAGCGACGATTCTGCTCAGGGTCATGGAGACCAATCCACACTGGTTTGTTCTTCTGGTAGGCAGAGATATGGGAAGCAATGACGTCTGCCTCTGCAGAGTCCAATATTGAGGCCAAGTGAGCCCCATGTCCGTATGCCTGGCAGTCGTACTCAGCCTCAGCCCAGCTCAGGGGGTAGCGGAAATACCCATAACAATTTGCCTTGTAAAAAAACCATCCATTGGGGCAAGAAGAGCGGACCTGTGCAGCTTCCAGCACATTACTAACGGCCAGAGCACCGGGAAGCAGCAGCAGTGGAAACCAAGAAACCATGG
Full Trace Sequence: GGGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGGCTTGTACTTGCACACGTACTGCTTGACTTCCTTGCAGTTACTGTCATTCCACTTCACAAAGCCCTCCTTGCAGGACAGTTCCCCACAGTACTCAGCTGAATTGTAGTTGTCCGGCTGCCCAGCGAGCCACGAGCGGTAATTGTACATGGAGCCATCATTCCACTTCCAGCGACGATTCTGCTCAGGGTCATGGAGACCAATCCACACTGGTTTGTTCTTCTGGTAGGCAGAGATATGGGAAGCAATGACGTCTGCCTCTGCAGAGTCCAATATTGAGGCCAAGTGAGCCCCATGTCCGTATGCCTGGCAGTCGTACTCAGCCTCAGCCCAGCTCAGGGGGTAGCGGAAATACCCATAACAATTTGCCTTGTAAAAAAACCATCCATTGGGGCAAGAAGAGCGGACCTGTGCAGCTTCCAGCACATTACTAACGGCCAGAGCACCGGGAAGCAGCAGCAGTGGAAACCAAGAAACCATGGTGCCAACTTTTTTTGACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAAAACGTCACTATCAGTCAAAATAAAATCATTAATTTGGGGCCCGAACTTAAAAAAAAACAGTGTTTTAACACGCCAAAAAATGGGCTTTTCCCGGCACGCTCTTCCCCGTTGTTTCAAATCCGCTGAAATTTAAAAAGATAGTTTTTTATTCTACGAACAGAAGAAAAAAAAAAAAAAAAAAAAAAAATAAAAAAAATAAAAATTATATAGAAGAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGCTTGTACTTGCACAC