ORFeome > MGC64526 ORF1 – XORFeome v1.0

MGC64526 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6255202
Gene Page ID:
ORF Xenbase ID: 17258523

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056856
Original XGC clone length: 1251

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: B06

Sequences - 5ʹ (forward) EST

Accession: JZ839367
dbEST ID: 79657069
Trimmed Sequence: ATGAACTCATTTTGTGTCTTGGGCTTGTACATCAATGCCTTATTATTACACAGACAACAAGTCCTCCGAATTTTCCCTACTGATGAGGATCAGGTGAACCTGGTGAGGGCGTTGGAAGATCTGGAACATTTACAGATCGATTTTTGGACAAGTCCCTCAAGAGTCCTTTTGCCCATTGATATCCGAGTTCCATTCCGCAATCTGCAATCAGTGAAAGTCTACCTGGAATCCAACAATATCCAGTACAGCATTATGATTCACGACATCCAGAGTTTGCTGAATGAAGAGCAAAACGATATGAGACGTAATCGTGCCACTGAAAACACAAGGTCTACTGACAGCTTCAATTATGCTGCCTATCATACATTTGATGAGATCAACGCCTTTATCGACAATTTGGTTAGAGAAAATCCAAATTTGGTCAGCAAAATACAGATTGGCTCAAGTTATGAAGGCCGTCCTCTTAATGTTCTGAAGTTCAGCACAGGTCCCAACCGCCCGGCATTCTGGATTGACACTGGTATCCATTCCCGTGAGTGGGTCACACAAGCTAGTGGTGTTTGGTTTGCCAAAAAGATTGTAACAGATTATGGGAAAGATGCATCCTTGACAAATACACTCAACAAAATTGATATCCTCTTGGAAATTGTGACCAAACCTGATGGCTTTGTTTACACTCATACCTCCGAATCGTATGTGGCGCAAAACCAGATCTCCAAATTCTGGGTTTCCGCCTGTATTGGAAACTGAACCCCAACCAGAACCTGGGGATGCCAGGGCCTTTGGGAAGTTCCCGGGGCTTCAAGCCTTCAA
Full Trace Sequence: CGACTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACTCATTTTGTGTCTTGGGCTTGTACATCAATGCCTTATTATTACACAGACAACAAGTCCTCCGAATTTTCCCTACTGATGAGGATCAGGTGAACCTGGTGAGGGCGTTGGAAGATCTGGAACATTTACAGATCGATTTTTGGACAAGTCCCTCAAGAGTCCTTTTGCCCATTGATATCCGAGTTCCATTCCGCAATCTGCAATCAGTGAAAGTCTACCTGGAATCCAACAATATCCAGTACAGCATTATGATTCACGACATCCAGAGTTTGCTGAATGAAGAGCAAAACGATATGAGACGTAATCGTGCCACTGAAAACACAAGGTCTACTGACAGCTTCAATTATGCTGCCTATCATACATTTGATGAGATCAACGCCTTTATCGACAATTTGGTTAGAGAAAATCCAAATTTGGTCAGCAAAATACAGATTGGCTCAAGTTATGAAGGCCGTCCTCTTAATGTTCTGAAGTTCAGCACAGGTCCCAACCGCCCGGCATTCTGGATTGACACTGGTATCCATTCCCGTGAGTGGGTCACACAAGCTAGTGGTGTTTGGTTTGCCAAAAAGATTGTAACAGATTATGGGAAAGATGCATCCTTGACAAATACACTCAACAAAATTGATATCCTCTTGGAAATTGTGACCAAACCTGATGGCTTTGTTTACACTCATACCTCCGAATCGTATGTGGCGCAAAACCAGATCTCCAAATTCTGGGTTTCCGCCTGTATTGGAAACTGAACCCCAACCAGAACCTGGGGATGCCAGGGCCTTTGGGAAGTTCCCGGGGCTTCAAGCCTTCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACTCATTTTGTGTCTTGGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839366
dbEST ID: 79657068
Trimmed Sequence: ATAAGGATTATCACGGGTGTGCTCAATCAGCTTGGTGAGTGCAAGCCAAGTCTCCTCTGCAGTTGGAATGATTTGGTTAGCTGGTAGTGCAAATCCATAGCGGCCTGTGTCACGCAGCTCAAAGGTGTAGGAGTGCTTAATTCCCTGATCGTAGGTCCAGTCAATGGTTCCTCCACTTGCTTGATAGATCGTAGTAATTATGCTGCCATAGGTGTAAGCTGTTCCATACAGTGAGGCCAAGGCATTAACAGCATCCCTTGACACAGCGTTTAGCTCATCGTGGTTGGGGGCTCTGGCACTAGTATATCCATATGGAAAGAGAAGCATCTGGGAGTAGCTGTGAATGGAGACAAAGCCTTTGATGTTGCCGTGACTTTTCACAAAGTCCACAATGGCTTTCACTTCAGGTTCAGAATGGGCAGCGCGTCCTCTGTAGGTTTCAGTGCAGGCATTTGAGCTTGAGCCAGGACCTCCAAAGCCTGCATCCCAGTTTCTGTTGGGGTCAGTTCCAATACAGCGGGAACCAGAATTTGGAGATCTGGTTTTGCGCCACATACGATTCGATGTATGAGTGTAAACAAGCCCTCAGGGTTGGTCACAATTTCCAAGAGGAATCAATTTTTTTGAGTGTATTTGTCAAAGAAGCATCTTTCCCATAATCTGTTAACATTCTTTTTGGGCAAACAAAACCCCACTAACCTTGTGTTACACCCCTTCCGGGGAATGGAAAACCAAGTGGTTAAATCCCGAAAAAGGCCCGGN
Full Trace Sequence: CGTGGAAACCGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATAAGGATTATCACGGGTGTGCTCAATCAGCTTGGTGAGTGCAAGCCAAGTCTCCTCTGCAGTTGGAATGATTTGGTTAGCTGGTAGTGCAAATCCATAGCGGCCTGTGTCACGCAGCTCAAAGGTGTAGGAGTGCTTAATTCCCTGATCGTAGGTCCAGTCAATGGTTCCTCCACTTGCTTGATAGATCGTAGTAATTATGCTGCCATAGGTGTAAGCTGTTCCATACAGTGAGGCCAAGGCATTAACAGCATCCCTTGACACAGCGTTTAGCTCATCGTGGTTGGGGGCTCTGGCACTAGTATATCCATATGGAAAGAGAAGCATCTGGGAGTAGCTGTGAATGGAGACAAAGCCTTTGATGTTGCCGTGACTTTTCACAAAGTCCACAATGGCTTTCACTTCAGGTTCAGAATGGGCAGCGCGTCCTCTGTAGGTTTCAGTGCAGGCATTTGAGCTTGAGCCAGGACCTCCAAAGCCTGCATCCCAGTTTCTGTTGGGGTCAGTTCCAATACAGCGGGAACCAGAATTTGGAGATCTGGTTTTGCGCCACATACGATTCGATGTATGAGTGTAAACAAGCCCTCAGGGTTGGTCACAATTTCCAAGAGGAATCAATTTTTTTGAGTGTATTTGTCAAAGAAGCATCTTTCCCATAATCTGTTAACATTCTTTTTGGGCAAACAAAACCCCACTAACCTTGTGTTACACCCCTTCCGGGGAATGGAAAACCAAGTGGTTAAATCCCGAAAAAGGCCCGGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAAGGATTATCACGGGTGTGCT